Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635367_at:

>probe:Drosophila_2:1635367_at:156:697; Interrogation_Position=5477; Antisense; TTTAGAAATGCCCAAGAACCAAGTT
>probe:Drosophila_2:1635367_at:235:379; Interrogation_Position=5492; Antisense; GAACCAAGTTCATGACAAAGTGCAA
>probe:Drosophila_2:1635367_at:269:509; Interrogation_Position=5511; Antisense; GTGCAATATGCATTTACTCTAAGAA
>probe:Drosophila_2:1635367_at:459:615; Interrogation_Position=5542; Antisense; TGCACCCGAATATATGGAGTCTAGC
>probe:Drosophila_2:1635367_at:296:431; Interrogation_Position=5558; Antisense; GAGTCTAGCGACGTGAATTGTGTCA
>probe:Drosophila_2:1635367_at:197:693; Interrogation_Position=5631; Antisense; TTTCGAGACGTAGCCAAAAGCCCAT
>probe:Drosophila_2:1635367_at:413:37; Interrogation_Position=5712; Antisense; TTTGCTGAGGGAACGTTTAAACTGA
>probe:Drosophila_2:1635367_at:671:605; Interrogation_Position=5734; Antisense; TGAGGTTTTTGTTTCGATTCGCACG
>probe:Drosophila_2:1635367_at:573:463; Interrogation_Position=5749; Antisense; GATTCGCACGTGAACCACATCAGAG
>probe:Drosophila_2:1635367_at:637:451; Interrogation_Position=5783; Antisense; GATCGGTCAGTATCACAGTATCAGA
>probe:Drosophila_2:1635367_at:245:685; Interrogation_Position=5801; Antisense; TATCAGACGGTTGGAAGGGCCACTC
>probe:Drosophila_2:1635367_at:327:373; Interrogation_Position=5814; Antisense; GAAGGGCCACTCAGTGAGATACATA
>probe:Drosophila_2:1635367_at:632:685; Interrogation_Position=5837; Antisense; TATACACTTATCCATTTGCATGAAA
>probe:Drosophila_2:1635367_at:173:271; Interrogation_Position=5892; Antisense; CGAACCGAACGGCAAAACATTATAT

Paste this into a BLAST search page for me
TTTAGAAATGCCCAAGAACCAAGTTGAACCAAGTTCATGACAAAGTGCAAGTGCAATATGCATTTACTCTAAGAATGCACCCGAATATATGGAGTCTAGCGAGTCTAGCGACGTGAATTGTGTCATTTCGAGACGTAGCCAAAAGCCCATTTTGCTGAGGGAACGTTTAAACTGATGAGGTTTTTGTTTCGATTCGCACGGATTCGCACGTGAACCACATCAGAGGATCGGTCAGTATCACAGTATCAGATATCAGACGGTTGGAAGGGCCACTCGAAGGGCCACTCAGTGAGATACATATATACACTTATCCATTTGCATGAAACGAACCGAACGGCAAAACATTATAT

Full Affymetrix probeset data:

Annotations for 1635367_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime