FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635368_at:

>probe:Drosophila_2:1635368_at:689:403; Interrogation_Position=1007; Antisense; GACTGCCATATTTGCAGAGGACGAA
>probe:Drosophila_2:1635368_at:319:129; Interrogation_Position=1076; Antisense; ACCAGCAGTGTGGTATTGACCATCT
>probe:Drosophila_2:1635368_at:20:713; Interrogation_Position=1091; Antisense; TTGACCATCTAGGTGCTTAATCAGC
>probe:Drosophila_2:1635368_at:543:365; Interrogation_Position=1288; Antisense; GAATCTACAGACTTGGCTTTGGCAG
>probe:Drosophila_2:1635368_at:368:165; Interrogation_Position=1347; Antisense; AAATGATTACCGCATGCAAAACATG
>probe:Drosophila_2:1635368_at:12:143; Interrogation_Position=1367; Antisense; ACATGAACCGGAGACGTCGGTCAAA
>probe:Drosophila_2:1635368_at:550:387; Interrogation_Position=1419; Antisense; GAAAAGTGAATGTCGCTGCTGCTCT
>probe:Drosophila_2:1635368_at:212:597; Interrogation_Position=1429; Antisense; TGTCGCTGCTGCTCTTGCACTTTAA
>probe:Drosophila_2:1635368_at:629:377; Interrogation_Position=895; Antisense; GAAGCGCAATAGACGAGTCCCAGGA
>probe:Drosophila_2:1635368_at:23:613; Interrogation_Position=937; Antisense; TGAAAGGAGTTGACGCCCTCGACAG
>probe:Drosophila_2:1635368_at:724:723; Interrogation_Position=946; Antisense; TTGACGCCCTCGACAGCGCAGGATA
>probe:Drosophila_2:1635368_at:343:349; Interrogation_Position=963; Antisense; GCAGGATACCTGGAGAATTCACAAT
>probe:Drosophila_2:1635368_at:639:245; Interrogation_Position=978; Antisense; AATTCACAATTTTCGAACACCGGCA
>probe:Drosophila_2:1635368_at:131:385; Interrogation_Position=992; Antisense; GAACACCGGCAAGATGACTGCCATA

Paste this into a BLAST search page for me
GACTGCCATATTTGCAGAGGACGAAACCAGCAGTGTGGTATTGACCATCTTTGACCATCTAGGTGCTTAATCAGCGAATCTACAGACTTGGCTTTGGCAGAAATGATTACCGCATGCAAAACATGACATGAACCGGAGACGTCGGTCAAAGAAAAGTGAATGTCGCTGCTGCTCTTGTCGCTGCTGCTCTTGCACTTTAAGAAGCGCAATAGACGAGTCCCAGGATGAAAGGAGTTGACGCCCTCGACAGTTGACGCCCTCGACAGCGCAGGATAGCAGGATACCTGGAGAATTCACAATAATTCACAATTTTCGAACACCGGCAGAACACCGGCAAGATGACTGCCATA

Full Affymetrix probeset data:

Annotations for 1635368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720