FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635370_at:

>probe:Drosophila_2:1635370_at:239:215; Interrogation_Position=488; Antisense; AAGTACGCGCTTCAAACGGTGGAGA
>probe:Drosophila_2:1635370_at:44:589; Interrogation_Position=525; Antisense; TGGAGCAGACGAAGCCTGGCAGTAT
>probe:Drosophila_2:1635370_at:378:175; Interrogation_Position=564; Antisense; AAACGTACTATTGCTGTGGCCGCGA
>probe:Drosophila_2:1635370_at:287:521; Interrogation_Position=579; Antisense; GTGGCCGCGACAGTGCCCAAGACTA
>probe:Drosophila_2:1635370_at:108:311; Interrogation_Position=635; Antisense; CCAAGTAGCTGTTGCAAGGACGACA
>probe:Drosophila_2:1635370_at:67:411; Interrogation_Position=653; Antisense; GACGACAGCTGTGTGAATCCACTGA
>probe:Drosophila_2:1635370_at:40:145; Interrogation_Position=673; Antisense; ACTGAATCTATATGTGCGCGGCTGC
>probe:Drosophila_2:1635370_at:618:623; Interrogation_Position=687; Antisense; TGCGCGGCTGCCTCATCAAAGTGGA
>probe:Drosophila_2:1635370_at:544:97; Interrogation_Position=724; Antisense; AGATGAGGCAACCACTCTGGGCTAT
>probe:Drosophila_2:1635370_at:268:537; Interrogation_Position=758; Antisense; GGTCTGCTCGGATTCAACGCTGTCA
>probe:Drosophila_2:1635370_at:140:201; Interrogation_Position=773; Antisense; AACGCTGTCATTCTATTGCTGGCCA
>probe:Drosophila_2:1635370_at:684:33; Interrogation_Position=797; Antisense; ATCATCTTGGCCATTCACTACACCA
>probe:Drosophila_2:1635370_at:529:251; Interrogation_Position=820; Antisense; CAACCGGCGGAGACGATATAACTAT
>probe:Drosophila_2:1635370_at:174:177; Interrogation_Position=922; Antisense; AAACCCAGCGTTACTTGCCAAGCAA

Paste this into a BLAST search page for me
AAGTACGCGCTTCAAACGGTGGAGATGGAGCAGACGAAGCCTGGCAGTATAAACGTACTATTGCTGTGGCCGCGAGTGGCCGCGACAGTGCCCAAGACTACCAAGTAGCTGTTGCAAGGACGACAGACGACAGCTGTGTGAATCCACTGAACTGAATCTATATGTGCGCGGCTGCTGCGCGGCTGCCTCATCAAAGTGGAAGATGAGGCAACCACTCTGGGCTATGGTCTGCTCGGATTCAACGCTGTCAAACGCTGTCATTCTATTGCTGGCCAATCATCTTGGCCATTCACTACACCACAACCGGCGGAGACGATATAACTATAAACCCAGCGTTACTTGCCAAGCAA

Full Affymetrix probeset data:

Annotations for 1635370_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720