FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635371_at:

>probe:Drosophila_2:1635371_at:407:259; Interrogation_Position=1020; Antisense; CACTCTCTCTTACACACAATAACAT
>probe:Drosophila_2:1635371_at:94:607; Interrogation_Position=1109; Antisense; TGATGAGCGCGAAAGGAAACTATTT
>probe:Drosophila_2:1635371_at:585:97; Interrogation_Position=1134; Antisense; AGATGCTAAGCATTCGAGTGGCGAA
>probe:Drosophila_2:1635371_at:16:365; Interrogation_Position=1225; Antisense; GAATCTAGACTTTAAACGCTGTCGC
>probe:Drosophila_2:1635371_at:645:175; Interrogation_Position=1238; Antisense; AAACGCTGTCGCTTAGTGAAAGGCA
>probe:Drosophila_2:1635371_at:150:205; Interrogation_Position=1257; Antisense; AAGGCAGGAATGGTTTACGATTTAT
>probe:Drosophila_2:1635371_at:369:29; Interrogation_Position=1282; Antisense; ATACGATGTGTTTTACCTTGGCATA
>probe:Drosophila_2:1635371_at:418:89; Interrogation_Position=1307; Antisense; AGTAAGCATTTTTCACCTCTCTAGA
>probe:Drosophila_2:1635371_at:475:177; Interrogation_Position=1372; Antisense; AAACGAGTGCTGAATTTTGGGCAGA
>probe:Drosophila_2:1635371_at:27:361; Interrogation_Position=1436; Antisense; GCAACGAAAACTGCGAGCTACAAAG
>probe:Drosophila_2:1635371_at:691:643; Interrogation_Position=941; Antisense; TCTCTCTGTGTCTAGGATCGCAATC
>probe:Drosophila_2:1635371_at:228:451; Interrogation_Position=956; Antisense; GATCGCAATCGCACCCAAATGTAAA
>probe:Drosophila_2:1635371_at:230:61; Interrogation_Position=974; Antisense; ATGTAAACGCACTCGAGCTGCTGCA
>probe:Drosophila_2:1635371_at:9:347; Interrogation_Position=999; Antisense; GCAAGGACACGCTCGGAAACACACT

Paste this into a BLAST search page for me
CACTCTCTCTTACACACAATAACATTGATGAGCGCGAAAGGAAACTATTTAGATGCTAAGCATTCGAGTGGCGAAGAATCTAGACTTTAAACGCTGTCGCAAACGCTGTCGCTTAGTGAAAGGCAAAGGCAGGAATGGTTTACGATTTATATACGATGTGTTTTACCTTGGCATAAGTAAGCATTTTTCACCTCTCTAGAAAACGAGTGCTGAATTTTGGGCAGAGCAACGAAAACTGCGAGCTACAAAGTCTCTCTGTGTCTAGGATCGCAATCGATCGCAATCGCACCCAAATGTAAAATGTAAACGCACTCGAGCTGCTGCAGCAAGGACACGCTCGGAAACACACT

Full Affymetrix probeset data:

Annotations for 1635371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720