Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635372_a_at:

>probe:Drosophila_2:1635372_a_at:378:695; Interrogation_Position=1557; Antisense; TTTCAAAACTGCAAGAACTCCCCTC
>probe:Drosophila_2:1635372_a_at:138:361; Interrogation_Position=1567; Antisense; GCAAGAACTCCCCTCGGAACGAGAA
>probe:Drosophila_2:1635372_a_at:71:161; Interrogation_Position=1590; Antisense; AAAACAACCATCACTTTCGTCTGGG
>probe:Drosophila_2:1635372_a_at:610:529; Interrogation_Position=1613; Antisense; GGGTTCTCAAAATATTTGCCAAGAA
>probe:Drosophila_2:1635372_a_at:252:311; Interrogation_Position=1630; Antisense; GCCAAGAAGTGCGTAATTCCCGTAG
>probe:Drosophila_2:1635372_a_at:16:191; Interrogation_Position=1798; Antisense; AACTTATGAGTTCCCATTTGCAACA
>probe:Drosophila_2:1635372_a_at:61:429; Interrogation_Position=1805; Antisense; GAGTTCCCATTTGCAACATCAACAT
>probe:Drosophila_2:1635372_a_at:265:189; Interrogation_Position=1825; Antisense; AACATCGCACACTCAATGGGCTTCA
>probe:Drosophila_2:1635372_a_at:148:63; Interrogation_Position=1840; Antisense; ATGGGCTTCATAAATTGTTCCTTTT
>probe:Drosophila_2:1635372_a_at:671:469; Interrogation_Position=1856; Antisense; GTTCCTTTTTTGTATATCTTAGATG
>probe:Drosophila_2:1635372_a_at:480:183; Interrogation_Position=1920; Antisense; AAAAGTATCGTCTCTCATGCGGAGC
>probe:Drosophila_2:1635372_a_at:154:271; Interrogation_Position=1935; Antisense; CATGCGGAGCTCGATGACATTTAGA
>probe:Drosophila_2:1635372_a_at:623:601; Interrogation_Position=1979; Antisense; TGTATATCTGCCACAACACATCCAA
>probe:Drosophila_2:1635372_a_at:52:255; Interrogation_Position=2001; Antisense; CAACATTCGGCCTTTCCATATATAC

Paste this into a BLAST search page for me
TTTCAAAACTGCAAGAACTCCCCTCGCAAGAACTCCCCTCGGAACGAGAAAAAACAACCATCACTTTCGTCTGGGGGGTTCTCAAAATATTTGCCAAGAAGCCAAGAAGTGCGTAATTCCCGTAGAACTTATGAGTTCCCATTTGCAACAGAGTTCCCATTTGCAACATCAACATAACATCGCACACTCAATGGGCTTCAATGGGCTTCATAAATTGTTCCTTTTGTTCCTTTTTTGTATATCTTAGATGAAAAGTATCGTCTCTCATGCGGAGCCATGCGGAGCTCGATGACATTTAGATGTATATCTGCCACAACACATCCAACAACATTCGGCCTTTCCATATATAC

Full Affymetrix probeset data:

Annotations for 1635372_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime