Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635374_at:

>probe:Drosophila_2:1635374_at:725:345; Interrogation_Position=1016; Antisense; GCATGTTTCCCGCAGGATCAAACGA
>probe:Drosophila_2:1635374_at:328:545; Interrogation_Position=1030; Antisense; GGATCAAACGACTTGTGCGGCACAA
>probe:Drosophila_2:1635374_at:310:529; Interrogation_Position=1055; Antisense; GGGTTTCGAATTCAGCACTTTGCAC
>probe:Drosophila_2:1635374_at:247:199; Interrogation_Position=1080; Antisense; AACGACGTGGCCATACTGACGTTGA
>probe:Drosophila_2:1635374_at:528:603; Interrogation_Position=1096; Antisense; TGACGTTGAGTGAACCAGTGCCCTT
>probe:Drosophila_2:1635374_at:389:529; Interrogation_Position=1126; Antisense; GGGAGATCCAACCAATTTGCCTGCC
>probe:Drosophila_2:1635374_at:725:357; Interrogation_Position=1166; Antisense; GCAATCCCGATCATACAGTGGCCAA
>probe:Drosophila_2:1635374_at:514:373; Interrogation_Position=1213; Antisense; GAAGTCTTCGGGAGAATGGGCCACA
>probe:Drosophila_2:1635374_at:629:155; Interrogation_Position=1235; Antisense; ACAGCCATCCATCCTGCAGAAGGTG
>probe:Drosophila_2:1635374_at:180:399; Interrogation_Position=1274; Antisense; GACAAATGCCGAGTGTGCCAGGAAA
>probe:Drosophila_2:1635374_at:494:163; Interrogation_Position=1296; Antisense; AAATATGGACGTGCAGCGCCTGGTG
>probe:Drosophila_2:1635374_at:347:87; Interrogation_Position=1330; Antisense; AGTCGATGATTTGCGCTGGTCAGGC
>probe:Drosophila_2:1635374_at:509:327; Interrogation_Position=1453; Antisense; GCGGCAAGGGTCAATATCCTGGCGT
>probe:Drosophila_2:1635374_at:267:621; Interrogation_Position=1498; Antisense; TGCTGCCCTGGATCTACAAGAACAT

Paste this into a BLAST search page for me
GCATGTTTCCCGCAGGATCAAACGAGGATCAAACGACTTGTGCGGCACAAGGGTTTCGAATTCAGCACTTTGCACAACGACGTGGCCATACTGACGTTGATGACGTTGAGTGAACCAGTGCCCTTGGGAGATCCAACCAATTTGCCTGCCGCAATCCCGATCATACAGTGGCCAAGAAGTCTTCGGGAGAATGGGCCACAACAGCCATCCATCCTGCAGAAGGTGGACAAATGCCGAGTGTGCCAGGAAAAAATATGGACGTGCAGCGCCTGGTGAGTCGATGATTTGCGCTGGTCAGGCGCGGCAAGGGTCAATATCCTGGCGTTGCTGCCCTGGATCTACAAGAACAT

Full Affymetrix probeset data:

Annotations for 1635374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime