FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635375_at:

>probe:Drosophila_2:1635375_at:511:679; Interrogation_Position=1084; Antisense; TAGTGAGCCCAAGGTCAGCAGGTGT
>probe:Drosophila_2:1635375_at:293:517; Interrogation_Position=1109; Antisense; GTGTGGGCGATCGTCAACTGCTGCA
>probe:Drosophila_2:1635375_at:58:81; Interrogation_Position=1149; Antisense; AGGTGCGGTACAACTGCTTCGAGGA
>probe:Drosophila_2:1635375_at:404:49; Interrogation_Position=1180; Antisense; ATGCCATGGAGCCTTCTGGGACATC
>probe:Drosophila_2:1635375_at:626:285; Interrogation_Position=1195; Antisense; CTGGGACATCAATCCGTGTGCCGAT
>probe:Drosophila_2:1635375_at:443:223; Interrogation_Position=1233; Antisense; AAGGTGCGCTCACCAAGGTCCTGGA
>probe:Drosophila_2:1635375_at:551:411; Interrogation_Position=1256; Antisense; GACGCCTTCCAAAACCAATGAGCAT
>probe:Drosophila_2:1635375_at:711:5; Interrogation_Position=1279; Antisense; ATTGAATTGATCCACTGACTTGCTC
>probe:Drosophila_2:1635375_at:614:401; Interrogation_Position=1295; Antisense; GACTTGCTCAGATTGTCTCAAACGC
>probe:Drosophila_2:1635375_at:6:135; Interrogation_Position=818; Antisense; ACGCCAGACTCGGTCGATTCTAGAG
>probe:Drosophila_2:1635375_at:615:121; Interrogation_Position=874; Antisense; AGCGGATGCGGATTTCTCGATCTAC
>probe:Drosophila_2:1635375_at:222:29; Interrogation_Position=893; Antisense; ATCTACAACCGTTCGTCTACGACTA
>probe:Drosophila_2:1635375_at:142:283; Interrogation_Position=918; Antisense; CTGCCAGGCCAATCTTTCAAATCAA
>probe:Drosophila_2:1635375_at:70:43; Interrogation_Position=970; Antisense; ATCGTGGCGTCCGTCGAACAGCATA

Paste this into a BLAST search page for me
TAGTGAGCCCAAGGTCAGCAGGTGTGTGTGGGCGATCGTCAACTGCTGCAAGGTGCGGTACAACTGCTTCGAGGAATGCCATGGAGCCTTCTGGGACATCCTGGGACATCAATCCGTGTGCCGATAAGGTGCGCTCACCAAGGTCCTGGAGACGCCTTCCAAAACCAATGAGCATATTGAATTGATCCACTGACTTGCTCGACTTGCTCAGATTGTCTCAAACGCACGCCAGACTCGGTCGATTCTAGAGAGCGGATGCGGATTTCTCGATCTACATCTACAACCGTTCGTCTACGACTACTGCCAGGCCAATCTTTCAAATCAAATCGTGGCGTCCGTCGAACAGCATA

Full Affymetrix probeset data:

Annotations for 1635375_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720