Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635376_at:

>probe:Drosophila_2:1635376_at:386:263; Interrogation_Position=5788; Antisense; CAGCGGCGGCGCAGTGGCATCACAT
>probe:Drosophila_2:1635376_at:704:83; Interrogation_Position=5800; Antisense; AGTGGCATCACATGTAGTCCTCCGC
>probe:Drosophila_2:1635376_at:89:679; Interrogation_Position=5814; Antisense; TAGTCCTCCGCAGGCACCGAGAAGG
>probe:Drosophila_2:1635376_at:107:229; Interrogation_Position=5865; Antisense; AATGGCGGCAGTCTATGTGATTATT
>probe:Drosophila_2:1635376_at:631:551; Interrogation_Position=5904; Antisense; GGAGAGCCTATTTTTACGTCTAAGC
>probe:Drosophila_2:1635376_at:195:343; Interrogation_Position=5927; Antisense; GCATTTTACTACTTATCCGTTTTGG
>probe:Drosophila_2:1635376_at:366:631; Interrogation_Position=5942; Antisense; TCCGTTTTGGAGAAGCGCTCACTCA
>probe:Drosophila_2:1635376_at:280:423; Interrogation_Position=5951; Antisense; GAGAAGCGCTCACTCATCCAGCGAG
>probe:Drosophila_2:1635376_at:348:251; Interrogation_Position=6069; Antisense; CAAGCGGCAACTGTAACCATTGGTT
>probe:Drosophila_2:1635376_at:634:723; Interrogation_Position=6164; Antisense; TTGTTGATAGTTTGAGCGGCCCAGT
>probe:Drosophila_2:1635376_at:198:87; Interrogation_Position=6186; Antisense; AGTGCCCTCCTCTAGTTATATATAT
>probe:Drosophila_2:1635376_at:302:679; Interrogation_Position=6281; Antisense; TAGGTTAGATTTTTGCCAGCACTTC
>probe:Drosophila_2:1635376_at:339:263; Interrogation_Position=6297; Antisense; CAGCACTTCGAATGTTGCCGCGCAG
>probe:Drosophila_2:1635376_at:408:625; Interrogation_Position=6312; Antisense; TGCCGCGCAGCAACTAAAGGAAGAA

Paste this into a BLAST search page for me
CAGCGGCGGCGCAGTGGCATCACATAGTGGCATCACATGTAGTCCTCCGCTAGTCCTCCGCAGGCACCGAGAAGGAATGGCGGCAGTCTATGTGATTATTGGAGAGCCTATTTTTACGTCTAAGCGCATTTTACTACTTATCCGTTTTGGTCCGTTTTGGAGAAGCGCTCACTCAGAGAAGCGCTCACTCATCCAGCGAGCAAGCGGCAACTGTAACCATTGGTTTTGTTGATAGTTTGAGCGGCCCAGTAGTGCCCTCCTCTAGTTATATATATTAGGTTAGATTTTTGCCAGCACTTCCAGCACTTCGAATGTTGCCGCGCAGTGCCGCGCAGCAACTAAAGGAAGAA

Full Affymetrix probeset data:

Annotations for 1635376_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime