FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635377_at:

>probe:Drosophila_2:1635377_at:27:571; Interrogation_Position=1416; Antisense; GGCATCATGCCAAGCCGATATTATT
>probe:Drosophila_2:1635377_at:634:521; Interrogation_Position=1442; Antisense; GGGCCTTTGAAAGCTAGCGCGTAGA
>probe:Drosophila_2:1635377_at:683:321; Interrogation_Position=1458; Antisense; GCGCGTAGAGCAGCAGCATGTATTT
>probe:Drosophila_2:1635377_at:244:705; Interrogation_Position=1481; Antisense; TTAGGAGCACCAACTGGCAGCGCTG
>probe:Drosophila_2:1635377_at:651:353; Interrogation_Position=1497; Antisense; GCAGCGCTGGCGTTGACGAGATTAC
>probe:Drosophila_2:1635377_at:441:461; Interrogation_Position=1516; Antisense; GATTACACCACAGCATCGGGACGAA
>probe:Drosophila_2:1635377_at:585:539; Interrogation_Position=1553; Antisense; GGTATTGATATCCACTTACGCATAA
>probe:Drosophila_2:1635377_at:528:707; Interrogation_Position=1568; Antisense; TTACGCATAATCTGCAACTGCACTT
>probe:Drosophila_2:1635377_at:259:641; Interrogation_Position=1619; Antisense; TCTGGCAGCCCATAGCACAAAGAAA
>probe:Drosophila_2:1635377_at:643:483; Interrogation_Position=1645; Antisense; GTATGAACCCAGCTTGTACTTGAGT
>probe:Drosophila_2:1635377_at:683:467; Interrogation_Position=1686; Antisense; GTTGAAGCGGCATTTCTAGTCAGTA
>probe:Drosophila_2:1635377_at:24:417; Interrogation_Position=1757; Antisense; GAGTAACCCCGATACAGGGCATCTG
>probe:Drosophila_2:1635377_at:244:521; Interrogation_Position=1773; Antisense; GGGCATCTGCATTAGCATGCATGCA
>probe:Drosophila_2:1635377_at:71:47; Interrogation_Position=1851; Antisense; ATCCGCACGGATCGATCATGGTATT

Paste this into a BLAST search page for me
GGCATCATGCCAAGCCGATATTATTGGGCCTTTGAAAGCTAGCGCGTAGAGCGCGTAGAGCAGCAGCATGTATTTTTAGGAGCACCAACTGGCAGCGCTGGCAGCGCTGGCGTTGACGAGATTACGATTACACCACAGCATCGGGACGAAGGTATTGATATCCACTTACGCATAATTACGCATAATCTGCAACTGCACTTTCTGGCAGCCCATAGCACAAAGAAAGTATGAACCCAGCTTGTACTTGAGTGTTGAAGCGGCATTTCTAGTCAGTAGAGTAACCCCGATACAGGGCATCTGGGGCATCTGCATTAGCATGCATGCAATCCGCACGGATCGATCATGGTATT

Full Affymetrix probeset data:

Annotations for 1635377_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720