Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635378_at:

>probe:Drosophila_2:1635378_at:152:293; Interrogation_Position=7008; Antisense; CGATTTTCAATGCAACGTCCGGTGA
>probe:Drosophila_2:1635378_at:215:511; Interrogation_Position=7029; Antisense; GTGAAGTTACCGAAGAGCCTGTCTC
>probe:Drosophila_2:1635378_at:716:101; Interrogation_Position=7042; Antisense; AGAGCCTGTCTCTTTAGCAGCTACG
>probe:Drosophila_2:1635378_at:372:337; Interrogation_Position=7078; Antisense; GCTACCGAGCGATATTCAATCCGAT
>probe:Drosophila_2:1635378_at:210:249; Interrogation_Position=7134; Antisense; AATTGTGCAATACGCGCTTGGGTAC
>probe:Drosophila_2:1635378_at:100:565; Interrogation_Position=7152; Antisense; TGGGTACTAACCAGCACCAACGGCT
>probe:Drosophila_2:1635378_at:348:197; Interrogation_Position=7170; Antisense; AACGGCTGTTGCTGTTGCGTCAGAG
>probe:Drosophila_2:1635378_at:448:137; Interrogation_Position=7212; Antisense; ACGAGCTGCGTCTTAAACATTATGT
>probe:Drosophila_2:1635378_at:206:227; Interrogation_Position=7256; Antisense; AAGGCACTGCGCCAATCTATTAGCA
>probe:Drosophila_2:1635378_at:663:231; Interrogation_Position=7295; Antisense; AATGCAGCTTACTATTCTGCGGCTG
>probe:Drosophila_2:1635378_at:623:625; Interrogation_Position=7318; Antisense; TGCCGCACAGCTTCCAACTAATTTG
>probe:Drosophila_2:1635378_at:134:479; Interrogation_Position=7414; Antisense; GTTTAGCTTCATGCACTTTTGGCAA
>probe:Drosophila_2:1635378_at:77:567; Interrogation_Position=7434; Antisense; GGCAAGTCATACTAACAGCTCTACT
>probe:Drosophila_2:1635378_at:607:117; Interrogation_Position=7450; Antisense; AGCTCTACTCTATGTTCTCGGCAAT

Paste this into a BLAST search page for me
CGATTTTCAATGCAACGTCCGGTGAGTGAAGTTACCGAAGAGCCTGTCTCAGAGCCTGTCTCTTTAGCAGCTACGGCTACCGAGCGATATTCAATCCGATAATTGTGCAATACGCGCTTGGGTACTGGGTACTAACCAGCACCAACGGCTAACGGCTGTTGCTGTTGCGTCAGAGACGAGCTGCGTCTTAAACATTATGTAAGGCACTGCGCCAATCTATTAGCAAATGCAGCTTACTATTCTGCGGCTGTGCCGCACAGCTTCCAACTAATTTGGTTTAGCTTCATGCACTTTTGGCAAGGCAAGTCATACTAACAGCTCTACTAGCTCTACTCTATGTTCTCGGCAAT

Full Affymetrix probeset data:

Annotations for 1635378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime