FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635379_at:

>probe:Drosophila_2:1635379_at:112:441; Interrogation_Position=1014; Antisense; GATGGAGCCGGAACAACGCAGAGAA
>probe:Drosophila_2:1635379_at:465:459; Interrogation_Position=1053; Antisense; GATTAATCACTACTTAACCGTTTTG
>probe:Drosophila_2:1635379_at:713:469; Interrogation_Position=1078; Antisense; GTTGCCACCCTCAAGAGCATTGGAT
>probe:Drosophila_2:1635379_at:178:345; Interrogation_Position=1094; Antisense; GCATTGGATACCCAGGTGAACTGCC
>probe:Drosophila_2:1635379_at:604:509; Interrogation_Position=1109; Antisense; GTGAACTGCCAACCCAAGCGAAACT
>probe:Drosophila_2:1635379_at:383:277; Interrogation_Position=1170; Antisense; CTTTTTGTTGAGCACTTTTCTGCCC
>probe:Drosophila_2:1635379_at:200:643; Interrogation_Position=1188; Antisense; TCTGCCCTTGATTTTGGCCATCAAA
>probe:Drosophila_2:1635379_at:200:383; Interrogation_Position=1230; Antisense; GAACGACCTTATACAGGATCCGGAA
>probe:Drosophila_2:1635379_at:694:357; Interrogation_Position=1323; Antisense; GCAACTTGGCTACTTTAAATGTCTA
>probe:Drosophila_2:1635379_at:599:469; Interrogation_Position=1374; Antisense; GTTGCCCTTATTTTGTTTATTCCAT
>probe:Drosophila_2:1635379_at:460:545; Interrogation_Position=920; Antisense; GGACGGGAGCCCACGAGGATACCAT
>probe:Drosophila_2:1635379_at:183:513; Interrogation_Position=949; Antisense; GTGGATTTCCAGATTAGCAACCTTT
>probe:Drosophila_2:1635379_at:612:201; Interrogation_Position=967; Antisense; AACCTTTGTCCCATCACAATTGATC
>probe:Drosophila_2:1635379_at:719:247; Interrogation_Position=984; Antisense; AATTGATCTCACATATTCCATCTAT

Paste this into a BLAST search page for me
GATGGAGCCGGAACAACGCAGAGAAGATTAATCACTACTTAACCGTTTTGGTTGCCACCCTCAAGAGCATTGGATGCATTGGATACCCAGGTGAACTGCCGTGAACTGCCAACCCAAGCGAAACTCTTTTTGTTGAGCACTTTTCTGCCCTCTGCCCTTGATTTTGGCCATCAAAGAACGACCTTATACAGGATCCGGAAGCAACTTGGCTACTTTAAATGTCTAGTTGCCCTTATTTTGTTTATTCCATGGACGGGAGCCCACGAGGATACCATGTGGATTTCCAGATTAGCAACCTTTAACCTTTGTCCCATCACAATTGATCAATTGATCTCACATATTCCATCTAT

Full Affymetrix probeset data:

Annotations for 1635379_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720