FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635380_at:

>probe:Drosophila_2:1635380_at:237:141; Interrogation_Position=107; Antisense; ACGGCACCCAGGCAACAACGGATAC
>probe:Drosophila_2:1635380_at:209:197; Interrogation_Position=123; Antisense; AACGGATACCCTCATCGCCAGTGAG
>probe:Drosophila_2:1635380_at:682:57; Interrogation_Position=13; Antisense; ATGTACCTCTTTGGCGTTTTCCTGC
>probe:Drosophila_2:1635380_at:386:45; Interrogation_Position=136; Antisense; ATCGCCAGTGAGACCATAACCAAGT
>probe:Drosophila_2:1635380_at:75:395; Interrogation_Position=162; Antisense; GAAATCCTTGCTGGGAATCACCACG
>probe:Drosophila_2:1635380_at:425:407; Interrogation_Position=189; Antisense; GACGTATACTCTAACCCAGGCAGGA
>probe:Drosophila_2:1635380_at:205:383; Interrogation_Position=212; Antisense; GAACTGCAAAGACCATCACCTACAT
>probe:Drosophila_2:1635380_at:240:139; Interrogation_Position=271; Antisense; ACTGCCGAAATTACCTCCGGTGGAG
>probe:Drosophila_2:1635380_at:311:433; Interrogation_Position=293; Antisense; GAGTGGGATCCACGACAGTCACGAT
>probe:Drosophila_2:1635380_at:551:89; Interrogation_Position=309; Antisense; AGTCACGATCAAATTCACCTCTGCA
>probe:Drosophila_2:1635380_at:372:417; Interrogation_Position=338; Antisense; GAGCTGGTATCAAGTCCCAAGTGGT
>probe:Drosophila_2:1635380_at:487:649; Interrogation_Position=51; Antisense; TCACGTCTGCTTCATCGATGCGAAC
>probe:Drosophila_2:1635380_at:323:637; Interrogation_Position=65; Antisense; TCGATGCGAACTTCGGCAGCGGAGA
>probe:Drosophila_2:1635380_at:573:73; Interrogation_Position=90; Antisense; AGGAAATGACTACACCTACGGCACC

Paste this into a BLAST search page for me
ACGGCACCCAGGCAACAACGGATACAACGGATACCCTCATCGCCAGTGAGATGTACCTCTTTGGCGTTTTCCTGCATCGCCAGTGAGACCATAACCAAGTGAAATCCTTGCTGGGAATCACCACGGACGTATACTCTAACCCAGGCAGGAGAACTGCAAAGACCATCACCTACATACTGCCGAAATTACCTCCGGTGGAGGAGTGGGATCCACGACAGTCACGATAGTCACGATCAAATTCACCTCTGCAGAGCTGGTATCAAGTCCCAAGTGGTTCACGTCTGCTTCATCGATGCGAACTCGATGCGAACTTCGGCAGCGGAGAAGGAAATGACTACACCTACGGCACC

Full Affymetrix probeset data:

Annotations for 1635380_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720