Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635381_a_at:

>probe:Drosophila_2:1635381_a_at:177:31; Interrogation_Position=311; Antisense; ATAACGATACCTGGCGGAGTGCGCA
>probe:Drosophila_2:1635381_a_at:233:637; Interrogation_Position=339; Antisense; TCGACGCCAGCGGACTGATGATCAT
>probe:Drosophila_2:1635381_a_at:700:405; Interrogation_Position=351; Antisense; GACTGATGATCATTCCCGGAGGCAT
>probe:Drosophila_2:1635381_a_at:149:151; Interrogation_Position=390; Antisense; ACATGCAGTTGCCTTTCGGCGGAGC
>probe:Drosophila_2:1635381_a_at:540:317; Interrogation_Position=419; Antisense; GCCGTCGACGATTTCTACCATGGAA
>probe:Drosophila_2:1635381_a_at:188:59; Interrogation_Position=473; Antisense; ATGATCATCGACTTCGTTCTGCCCA
>probe:Drosophila_2:1635381_a_at:520:471; Interrogation_Position=488; Antisense; GTTCTGCCCAACAAACATGAGTCGA
>probe:Drosophila_2:1635381_a_at:564:431; Interrogation_Position=506; Antisense; GAGTCGATGATCGAGGCCTACGACA
>probe:Drosophila_2:1635381_a_at:459:221; Interrogation_Position=530; Antisense; AAGTGGCGCAGCTGGGCCGATCCTA
>probe:Drosophila_2:1635381_a_at:488:77; Interrogation_Position=806; Antisense; AGGTATGCTGCGACTACGGATTGCA
>probe:Drosophila_2:1635381_a_at:77:141; Interrogation_Position=821; Antisense; ACGGATTGCATGTGGGCATCACCTG
>probe:Drosophila_2:1635381_a_at:147:251; Interrogation_Position=840; Antisense; CACCTGGTGGTCGAAGTCGGTGTCT
>probe:Drosophila_2:1635381_a_at:205:291; Interrogation_Position=857; Antisense; CGGTGTCTGAGGAGATCGGCATTCT
>probe:Drosophila_2:1635381_a_at:602:451; Interrogation_Position=870; Antisense; GATCGGCATTCTGTGCAAAGAGCTT

Paste this into a BLAST search page for me
ATAACGATACCTGGCGGAGTGCGCATCGACGCCAGCGGACTGATGATCATGACTGATGATCATTCCCGGAGGCATACATGCAGTTGCCTTTCGGCGGAGCGCCGTCGACGATTTCTACCATGGAAATGATCATCGACTTCGTTCTGCCCAGTTCTGCCCAACAAACATGAGTCGAGAGTCGATGATCGAGGCCTACGACAAAGTGGCGCAGCTGGGCCGATCCTAAGGTATGCTGCGACTACGGATTGCAACGGATTGCATGTGGGCATCACCTGCACCTGGTGGTCGAAGTCGGTGTCTCGGTGTCTGAGGAGATCGGCATTCTGATCGGCATTCTGTGCAAAGAGCTT

Full Affymetrix probeset data:

Annotations for 1635381_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime