FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635382_at:

>probe:Drosophila_2:1635382_at:293:9; Interrogation_Position=2352; Antisense; ATTCGCAGTCGACAGCCTTTATGCT
>probe:Drosophila_2:1635382_at:671:399; Interrogation_Position=2362; Antisense; GACAGCCTTTATGCTTTGCTACACA
>probe:Drosophila_2:1635382_at:27:317; Interrogation_Position=2366; Antisense; GCCTTTATGCTTTGCTACACACAAG
>probe:Drosophila_2:1635382_at:164:619; Interrogation_Position=2378; Antisense; TGCTACACACAAGACGATGCCAATG
>probe:Drosophila_2:1635382_at:377:251; Interrogation_Position=2387; Antisense; CAAGACGATGCCAATGCTGAAGGAG
>probe:Drosophila_2:1635382_at:271:335; Interrogation_Position=2402; Antisense; GCTGAAGGAGGCGAGATTATCTACA
>probe:Drosophila_2:1635382_at:614:425; Interrogation_Position=2414; Antisense; GAGATTATCTACAGGGTGGAGTTAC
>probe:Drosophila_2:1635382_at:413:549; Interrogation_Position=2431; Antisense; GGAGTTACCCGATATGGAGCAGATA
>probe:Drosophila_2:1635382_at:699:551; Interrogation_Position=2446; Antisense; GGAGCAGATAACTCTGATCTACTTG
>probe:Drosophila_2:1635382_at:489:455; Interrogation_Position=2452; Antisense; GATAACTCTGATCTACTTGGAGAAT
>probe:Drosophila_2:1635382_at:8:423; Interrogation_Position=2471; Antisense; GAGAATAATGATGCTGACTATCGTA
>probe:Drosophila_2:1635382_at:72:405; Interrogation_Position=2486; Antisense; GACTATCGTAAGTCGAGCATCTGAA
>probe:Drosophila_2:1635382_at:36:421; Interrogation_Position=2500; Antisense; GAGCATCTGAACAACCAACAATCAC
>probe:Drosophila_2:1635382_at:1:663; Interrogation_Position=2538; Antisense; TAAAACAACCACAAGAATCAACAGC

Paste this into a BLAST search page for me
ATTCGCAGTCGACAGCCTTTATGCTGACAGCCTTTATGCTTTGCTACACAGCCTTTATGCTTTGCTACACACAAGTGCTACACACAAGACGATGCCAATGCAAGACGATGCCAATGCTGAAGGAGGCTGAAGGAGGCGAGATTATCTACAGAGATTATCTACAGGGTGGAGTTACGGAGTTACCCGATATGGAGCAGATAGGAGCAGATAACTCTGATCTACTTGGATAACTCTGATCTACTTGGAGAATGAGAATAATGATGCTGACTATCGTAGACTATCGTAAGTCGAGCATCTGAAGAGCATCTGAACAACCAACAATCACTAAAACAACCACAAGAATCAACAGC

Full Affymetrix probeset data:

Annotations for 1635382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720