FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635383_at:

>probe:Drosophila_2:1635383_at:185:301; Interrogation_Position=2522; Antisense; CGCCTGGTGGCCCTAATATTGCTAG
>probe:Drosophila_2:1635383_at:108:339; Interrogation_Position=2542; Antisense; GCTAGGAACTGGCATTCACGGGACT
>probe:Drosophila_2:1635383_at:90:57; Interrogation_Position=2603; Antisense; ATGAGCCAGAAGACCACGCCTCCAG
>probe:Drosophila_2:1635383_at:41:281; Interrogation_Position=2622; Antisense; CTCCAGATTCCCAGTGAAGCCAAGT
>probe:Drosophila_2:1635383_at:657:611; Interrogation_Position=2668; Antisense; TGAAACACATACAAACCCCTACTAG
>probe:Drosophila_2:1635383_at:448:29; Interrogation_Position=2676; Antisense; ATACAAACCCCTACTAGCGCTCAGT
>probe:Drosophila_2:1635383_at:312:639; Interrogation_Position=2696; Antisense; TCAGTCTCCCGGACTTATCCTTGAG
>probe:Drosophila_2:1635383_at:253:277; Interrogation_Position=2709; Antisense; CTTATCCTTGAGTCGTTTCTGTACA
>probe:Drosophila_2:1635383_at:437:431; Interrogation_Position=2718; Antisense; GAGTCGTTTCTGTACATAGTTCATA
>probe:Drosophila_2:1635383_at:27:545; Interrogation_Position=2789; Antisense; GGATATCAGACCAATGCCCATGACA
>probe:Drosophila_2:1635383_at:271:391; Interrogation_Position=2817; Antisense; GAAAGCTACATTTCCTTCTAAATAA
>probe:Drosophila_2:1635383_at:192:241; Interrogation_Position=2856; Antisense; AATACTAGTGTCTCTTGTCAAGCGC
>probe:Drosophila_2:1635383_at:248:495; Interrogation_Position=2872; Antisense; GTCAAGCGCATTTAAGTCGCATAAA
>probe:Drosophila_2:1635383_at:521:673; Interrogation_Position=2934; Antisense; TAGCCCTAAGTCCAATCCCAAAGAT

Paste this into a BLAST search page for me
CGCCTGGTGGCCCTAATATTGCTAGGCTAGGAACTGGCATTCACGGGACTATGAGCCAGAAGACCACGCCTCCAGCTCCAGATTCCCAGTGAAGCCAAGTTGAAACACATACAAACCCCTACTAGATACAAACCCCTACTAGCGCTCAGTTCAGTCTCCCGGACTTATCCTTGAGCTTATCCTTGAGTCGTTTCTGTACAGAGTCGTTTCTGTACATAGTTCATAGGATATCAGACCAATGCCCATGACAGAAAGCTACATTTCCTTCTAAATAAAATACTAGTGTCTCTTGTCAAGCGCGTCAAGCGCATTTAAGTCGCATAAATAGCCCTAAGTCCAATCCCAAAGAT

Full Affymetrix probeset data:

Annotations for 1635383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720