FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635384_at:

>probe:Drosophila_2:1635384_at:435:591; Interrogation_Position=1044; Antisense; TGTGGAACCTTGCTGTACGTAGTCT
>probe:Drosophila_2:1635384_at:515:137; Interrogation_Position=1060; Antisense; ACGTAGTCTTCTTTGAGATCCTCAT
>probe:Drosophila_2:1635384_at:450:449; Interrogation_Position=1076; Antisense; GATCCTCATTGAGAGCCATGCCGGA
>probe:Drosophila_2:1635384_at:360:463; Interrogation_Position=1129; Antisense; GATTCGCTCTAATGTTTGGCCTTCA
>probe:Drosophila_2:1635384_at:122:725; Interrogation_Position=1144; Antisense; TTGGCCTTCAAATTCTTTCTGACGA
>probe:Drosophila_2:1635384_at:466:81; Interrogation_Position=1174; Antisense; AGGGTGATGACAGCCTAACCTGTTC
>probe:Drosophila_2:1635384_at:589:659; Interrogation_Position=1189; Antisense; TAACCTGTTCCTAGCCAGTGTGACG
>probe:Drosophila_2:1635384_at:448:517; Interrogation_Position=1206; Antisense; GTGTGACGCCACTTCAGTATTATCA
>probe:Drosophila_2:1635384_at:558:567; Interrogation_Position=807; Antisense; GGCACTGTGAGCACTGTGTGGTTCA
>probe:Drosophila_2:1635384_at:686:595; Interrogation_Position=823; Antisense; TGTGGTTCATGTTTGGAGCGGTCTC
>probe:Drosophila_2:1635384_at:289:161; Interrogation_Position=853; Antisense; ACAAGTTGGTGTTGGCCTTCTGCGT
>probe:Drosophila_2:1635384_at:439:581; Interrogation_Position=916; Antisense; TGGCCATCTTGTACCTGGTGACATT
>probe:Drosophila_2:1635384_at:17:613; Interrogation_Position=934; Antisense; TGACATTCTCCATTGTTACACCCAT
>probe:Drosophila_2:1635384_at:541:41; Interrogation_Position=957; Antisense; ATCGGTATCGGTGTTGGCCTCGGCA

Paste this into a BLAST search page for me
TGTGGAACCTTGCTGTACGTAGTCTACGTAGTCTTCTTTGAGATCCTCATGATCCTCATTGAGAGCCATGCCGGAGATTCGCTCTAATGTTTGGCCTTCATTGGCCTTCAAATTCTTTCTGACGAAGGGTGATGACAGCCTAACCTGTTCTAACCTGTTCCTAGCCAGTGTGACGGTGTGACGCCACTTCAGTATTATCAGGCACTGTGAGCACTGTGTGGTTCATGTGGTTCATGTTTGGAGCGGTCTCACAAGTTGGTGTTGGCCTTCTGCGTTGGCCATCTTGTACCTGGTGACATTTGACATTCTCCATTGTTACACCCATATCGGTATCGGTGTTGGCCTCGGCA

Full Affymetrix probeset data:

Annotations for 1635384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720