Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635385_at:

>probe:Drosophila_2:1635385_at:565:221; Interrogation_Position=1189; Antisense; AAGGTCTCACATCCCGAGGAGTGTT
>probe:Drosophila_2:1635385_at:401:341; Interrogation_Position=1255; Antisense; GCTAGCTTGCAACCGGAGTCGACGA
>probe:Drosophila_2:1635385_at:109:443; Interrogation_Position=1294; Antisense; GATGAGGATGCTGCTCCCGGACCGT
>probe:Drosophila_2:1635385_at:281:129; Interrogation_Position=1314; Antisense; ACCGTCTGGTGCCATTTCAGCAGAG
>probe:Drosophila_2:1635385_at:63:565; Interrogation_Position=1348; Antisense; TACGGCCCGAGTCCCAAGAAGGTGA
>probe:Drosophila_2:1635385_at:294:211; Interrogation_Position=1363; Antisense; AAGAAGGTGATCGTCCAGCCCGATA
>probe:Drosophila_2:1635385_at:130:577; Interrogation_Position=1440; Antisense; GGCCGAGGCCAAGGAGTCAACCGAT
>probe:Drosophila_2:1635385_at:286:201; Interrogation_Position=1458; Antisense; AACCGATCAGAATTAACCGCCGCTC
>probe:Drosophila_2:1635385_at:696:335; Interrogation_Position=1479; Antisense; GCTCGCTCTTGTTCTTTTTATACGA
>probe:Drosophila_2:1635385_at:26:173; Interrogation_Position=1549; Antisense; AAAGCGCGCCGTGAATTATTATAAA
>probe:Drosophila_2:1635385_at:39:371; Interrogation_Position=1624; Antisense; GAAGTGCTGATTTGTAAACCCGTGA
>probe:Drosophila_2:1635385_at:649:175; Interrogation_Position=1639; Antisense; AAACCCGTGAGCAGCGTCGACAAAA
>probe:Drosophila_2:1635385_at:384:401; Interrogation_Position=1664; Antisense; GACATTTATCCATTACGCTTTGTGT
>probe:Drosophila_2:1635385_at:378:457; Interrogation_Position=1731; Antisense; GATATCGATCGTACACGCTCTAATT

Paste this into a BLAST search page for me
AAGGTCTCACATCCCGAGGAGTGTTGCTAGCTTGCAACCGGAGTCGACGAGATGAGGATGCTGCTCCCGGACCGTACCGTCTGGTGCCATTTCAGCAGAGTACGGCCCGAGTCCCAAGAAGGTGAAAGAAGGTGATCGTCCAGCCCGATAGGCCGAGGCCAAGGAGTCAACCGATAACCGATCAGAATTAACCGCCGCTCGCTCGCTCTTGTTCTTTTTATACGAAAAGCGCGCCGTGAATTATTATAAAGAAGTGCTGATTTGTAAACCCGTGAAAACCCGTGAGCAGCGTCGACAAAAGACATTTATCCATTACGCTTTGTGTGATATCGATCGTACACGCTCTAATT

Full Affymetrix probeset data:

Annotations for 1635385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime