FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635387_at:

>probe:Drosophila_2:1635387_at:84:289; Interrogation_Position=1007; Antisense; CGGCCTTCAATGATCTCTTCATGAT
>probe:Drosophila_2:1635387_at:535:439; Interrogation_Position=1051; Antisense; GAGGCCAACACGACGGAATTGCTTT
>probe:Drosophila_2:1635387_at:62:363; Interrogation_Position=1066; Antisense; GAATTGCTTTTTGTATCCGTCGGCA
>probe:Drosophila_2:1635387_at:614:689; Interrogation_Position=1094; Antisense; TATTGAGTTCGTATGCGGGTCGCAA
>probe:Drosophila_2:1635387_at:261:531; Interrogation_Position=1110; Antisense; GGGTCGCAATCGATCGTGTCCTTTG
>probe:Drosophila_2:1635387_at:189:713; Interrogation_Position=670; Antisense; TTCGATTACCCAGAGGCCACATGTA
>probe:Drosophila_2:1635387_at:708:529; Interrogation_Position=747; Antisense; GGGTTTGCCCACCAAGATCTTGTGC
>probe:Drosophila_2:1635387_at:315:549; Interrogation_Position=790; Antisense; GGAGGTCCTTGGTTGCTAATGACGC
>probe:Drosophila_2:1635387_at:644:677; Interrogation_Position=818; Antisense; TAGAGCTACCAGTTCGTGTTCACAT
>probe:Drosophila_2:1635387_at:180:51; Interrogation_Position=841; Antisense; ATGCGTCACTGGTTCTTGGGCTATC
>probe:Drosophila_2:1635387_at:363:729; Interrogation_Position=856; Antisense; TTGGGCTATCTAACTGCGGACTACA
>probe:Drosophila_2:1635387_at:17:703; Interrogation_Position=899; Antisense; TTTTGGCACTGGCTCATATCATGAA
>probe:Drosophila_2:1635387_at:390:51; Interrogation_Position=928; Antisense; ATGCGCACTGCCATGTTGATCCTTG
>probe:Drosophila_2:1635387_at:678:57; Interrogation_Position=992; Antisense; ATGATGTGGTCATATCGGCCTTCAA

Paste this into a BLAST search page for me
CGGCCTTCAATGATCTCTTCATGATGAGGCCAACACGACGGAATTGCTTTGAATTGCTTTTTGTATCCGTCGGCATATTGAGTTCGTATGCGGGTCGCAAGGGTCGCAATCGATCGTGTCCTTTGTTCGATTACCCAGAGGCCACATGTAGGGTTTGCCCACCAAGATCTTGTGCGGAGGTCCTTGGTTGCTAATGACGCTAGAGCTACCAGTTCGTGTTCACATATGCGTCACTGGTTCTTGGGCTATCTTGGGCTATCTAACTGCGGACTACATTTTGGCACTGGCTCATATCATGAAATGCGCACTGCCATGTTGATCCTTGATGATGTGGTCATATCGGCCTTCAA

Full Affymetrix probeset data:

Annotations for 1635387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720