Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635388_s_at:

>probe:Drosophila_2:1635388_s_at:258:37; Interrogation_Position=172; Antisense; ATCATCGGCGAGTATGGTCTGCGCA
>probe:Drosophila_2:1635388_s_at:490:89; Interrogation_Position=221; Antisense; AGTACGCCCTGGCTAAGATCCGTAA
>probe:Drosophila_2:1635388_s_at:254:659; Interrogation_Position=234; Antisense; TAAGATCCGTAAGGCCGCTCGTGAG
>probe:Drosophila_2:1635388_s_at:197:207; Interrogation_Position=286; Antisense; AAGCGTCTGTTCCAGGGTAATGCCC
>probe:Drosophila_2:1635388_s_at:114:501; Interrogation_Position=320; Antisense; GTCTGGTCCGTATCGGTGTCCTGGA
>probe:Drosophila_2:1635388_s_at:608:431; Interrogation_Position=346; Antisense; GAGTCCCGCATGAAGCTCGATTACG
>probe:Drosophila_2:1635388_s_at:389:313; Interrogation_Position=360; Antisense; GCTCGATTACGTGCTGGGTCTGAAG
>probe:Drosophila_2:1635388_s_at:191:7; Interrogation_Position=385; Antisense; ATTGAGGACTTCTTGGAGCGTCGTC
>probe:Drosophila_2:1635388_s_at:438:501; Interrogation_Position=404; Antisense; GTCGTCTGCAGACGCAGGTGTTCAA
>probe:Drosophila_2:1635388_s_at:573:79; Interrogation_Position=419; Antisense; AGGTGTTCAAGCTGGGACTTGCCAA
>probe:Drosophila_2:1635388_s_at:366:115; Interrogation_Position=497; Antisense; AGCAGGTGGTCAACATCCCGTCGTT
>probe:Drosophila_2:1635388_s_at:309:587; Interrogation_Position=533; Antisense; TGGACTCCCAGAAGCACATCGACTT
>probe:Drosophila_2:1635388_s_at:317:291; Interrogation_Position=586; Antisense; CGTCCCGGTCGCGTCAAGAGGAAGA
>probe:Drosophila_2:1635388_s_at:340:115; Interrogation_Position=666; Antisense; AGCAGTGGTAGCCAGCTGTAGCCAA

Paste this into a BLAST search page for me
ATCATCGGCGAGTATGGTCTGCGCAAGTACGCCCTGGCTAAGATCCGTAATAAGATCCGTAAGGCCGCTCGTGAGAAGCGTCTGTTCCAGGGTAATGCCCGTCTGGTCCGTATCGGTGTCCTGGAGAGTCCCGCATGAAGCTCGATTACGGCTCGATTACGTGCTGGGTCTGAAGATTGAGGACTTCTTGGAGCGTCGTCGTCGTCTGCAGACGCAGGTGTTCAAAGGTGTTCAAGCTGGGACTTGCCAAAGCAGGTGGTCAACATCCCGTCGTTTGGACTCCCAGAAGCACATCGACTTCGTCCCGGTCGCGTCAAGAGGAAGAAGCAGTGGTAGCCAGCTGTAGCCAA

Full Affymetrix probeset data:

Annotations for 1635388_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime