Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635393_s_at:

>probe:Drosophila_2:1635393_s_at:56:1; Interrogation_Position=300; Antisense; AGCAGTTAAACTTTAACGTAGCAAG
>probe:Drosophila_2:1635393_s_at:395:391; Interrogation_Position=324; Antisense; GAAACCAACAAACCCAAGGCAGCGC
>probe:Drosophila_2:1635393_s_at:210:227; Interrogation_Position=339; Antisense; AAGGCAGCGCTCTGATTTCGCATTA
>probe:Drosophila_2:1635393_s_at:589:353; Interrogation_Position=342; Antisense; GCAGCGCTCTGATTTCGCATTAACT
>probe:Drosophila_2:1635393_s_at:700:693; Interrogation_Position=354; Antisense; TTTCGCATTAACTTTTCTTCAGCTG
>probe:Drosophila_2:1635393_s_at:651:709; Interrogation_Position=361; Antisense; TTAACTTTTCTTCAGCTGCTACCGA
>probe:Drosophila_2:1635393_s_at:354:689; Interrogation_Position=367; Antisense; TTTCTTCAGCTGCTACCGAAAACGC
>probe:Drosophila_2:1635393_s_at:227:641; Interrogation_Position=436; Antisense; TCTTTCGACCCCTGATTGTTTTATA
>probe:Drosophila_2:1635393_s_at:36:637; Interrogation_Position=440; Antisense; TCGACCCCTGATTGTTTTATAAGTT
>probe:Drosophila_2:1635393_s_at:693:29; Interrogation_Position=458; Antisense; ATAAGTTTTAAGCTCTTGTTGTACA
>probe:Drosophila_2:1635393_s_at:650:337; Interrogation_Position=469; Antisense; GCTCTTGTTGTACATATTAATTACG
>probe:Drosophila_2:1635393_s_at:512:3; Interrogation_Position=497; Antisense; ATTGGTAACTATGTTTAGCGCTTTA
>probe:Drosophila_2:1635393_s_at:599:123; Interrogation_Position=513; Antisense; AGCGCTTTAGTTGTAGTTGGAGCAA
>probe:Drosophila_2:1635393_s_at:92:357; Interrogation_Position=534; Antisense; GCAAAACTACTTTGCTTTTTTGGAT

Paste this into a BLAST search page for me
AGCAGTTAAACTTTAACGTAGCAAGGAAACCAACAAACCCAAGGCAGCGCAAGGCAGCGCTCTGATTTCGCATTAGCAGCGCTCTGATTTCGCATTAACTTTTCGCATTAACTTTTCTTCAGCTGTTAACTTTTCTTCAGCTGCTACCGATTTCTTCAGCTGCTACCGAAAACGCTCTTTCGACCCCTGATTGTTTTATATCGACCCCTGATTGTTTTATAAGTTATAAGTTTTAAGCTCTTGTTGTACAGCTCTTGTTGTACATATTAATTACGATTGGTAACTATGTTTAGCGCTTTAAGCGCTTTAGTTGTAGTTGGAGCAAGCAAAACTACTTTGCTTTTTTGGAT

Full Affymetrix probeset data:

Annotations for 1635393_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime