Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635394_at:

>probe:Drosophila_2:1635394_at:138:375; Interrogation_Position=1008; Antisense; GAAGAGCCCGTATGTTATCTGCTAA
>probe:Drosophila_2:1635394_at:309:393; Interrogation_Position=1072; Antisense; GAAATTTCGCTGATTACCGACGGCT
>probe:Drosophila_2:1635394_at:176:29; Interrogation_Position=1125; Antisense; ATACGTGACATGCAGTTTGAGCCCA
>probe:Drosophila_2:1635394_at:155:691; Interrogation_Position=1140; Antisense; TTTGAGCCCACGTTTTCGAAGGAAG
>probe:Drosophila_2:1635394_at:481:391; Interrogation_Position=1164; Antisense; GAAAGAACCACGCTTCACCAAATCG
>probe:Drosophila_2:1635394_at:204:107; Interrogation_Position=1191; Antisense; AGACAATTTGGCTTGCGTTCCGCTA
>probe:Drosophila_2:1635394_at:413:317; Interrogation_Position=1234; Antisense; GCCGGCGCCTTTTGATTACCAAGAA
>probe:Drosophila_2:1635394_at:630:449; Interrogation_Position=1259; Antisense; GATCGACTATGGCACAATACTGACT
>probe:Drosophila_2:1635394_at:390:239; Interrogation_Position=1274; Antisense; AATACTGACTGAGGTCCTGCTTCGG
>probe:Drosophila_2:1635394_at:469:599; Interrogation_Position=1291; Antisense; TGCTTCGGCGGAACCCCAAGTTTTG
>probe:Drosophila_2:1635394_at:635:431; Interrogation_Position=1317; Antisense; GATCGTTACTTTGTGCACGTACCCA
>probe:Drosophila_2:1635394_at:362:109; Interrogation_Position=1345; Antisense; AGAAGGCGCACCTGTTTCCTGGTCA
>probe:Drosophila_2:1635394_at:654:495; Interrogation_Position=1366; Antisense; GTCATGTGGCCGACCTGGAGATGAA
>probe:Drosophila_2:1635394_at:225:165; Interrogation_Position=1419; Antisense; AAATCTCAGCTCATAGTACTCTTAT

Paste this into a BLAST search page for me
GAAGAGCCCGTATGTTATCTGCTAAGAAATTTCGCTGATTACCGACGGCTATACGTGACATGCAGTTTGAGCCCATTTGAGCCCACGTTTTCGAAGGAAGGAAAGAACCACGCTTCACCAAATCGAGACAATTTGGCTTGCGTTCCGCTAGCCGGCGCCTTTTGATTACCAAGAAGATCGACTATGGCACAATACTGACTAATACTGACTGAGGTCCTGCTTCGGTGCTTCGGCGGAACCCCAAGTTTTGGATCGTTACTTTGTGCACGTACCCAAGAAGGCGCACCTGTTTCCTGGTCAGTCATGTGGCCGACCTGGAGATGAAAAATCTCAGCTCATAGTACTCTTAT

Full Affymetrix probeset data:

Annotations for 1635394_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime