FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635396_at:

>probe:Drosophila_2:1635396_at:19:635; Interrogation_Position=2016; Antisense; TCGCACTCCCTTTGGAAGTCGGTAT
>probe:Drosophila_2:1635396_at:142:219; Interrogation_Position=2031; Antisense; AAGTCGGTATCCCAATCAGCAGGAG
>probe:Drosophila_2:1635396_at:259:613; Interrogation_Position=2118; Antisense; TGAAAAGCCATATGCCTCGACTCTT
>probe:Drosophila_2:1635396_at:76:281; Interrogation_Position=2145; Antisense; CTGTTTCGCCAAACCGGTGGTGGAG
>probe:Drosophila_2:1635396_at:156:363; Interrogation_Position=2171; Antisense; GCAATTACTGGTTCTACGATCACGA
>probe:Drosophila_2:1635396_at:464:433; Interrogation_Position=2203; Antisense; GAGTGCAAGATCTTCACCACGGACA
>probe:Drosophila_2:1635396_at:40:363; Interrogation_Position=2238; Antisense; GAATAGAAACCGATTCCGTACCCTG
>probe:Drosophila_2:1635396_at:535:599; Interrogation_Position=2281; Antisense; TGTCTGCAGCCCCAAATAAACATGG
>probe:Drosophila_2:1635396_at:125:555; Interrogation_Position=2304; Antisense; GGAGCGATCCGAAAACGATGCCATG
>probe:Drosophila_2:1635396_at:264:435; Interrogation_Position=2389; Antisense; GAGGTGGATCCTATGATCAACCAGA
>probe:Drosophila_2:1635396_at:586:79; Interrogation_Position=2418; Antisense; AGGTCCTATGACTTATCGACAGCAG
>probe:Drosophila_2:1635396_at:397:727; Interrogation_Position=2482; Antisense; TTGGAGAACCCATGTCGCAGACCAG
>probe:Drosophila_2:1635396_at:340:265; Interrogation_Position=2499; Antisense; CAGACCAGGAGCAGATACGACACAT
>probe:Drosophila_2:1635396_at:678:95; Interrogation_Position=2511; Antisense; AGATACGACACATCCAGACGCGGTC

Paste this into a BLAST search page for me
TCGCACTCCCTTTGGAAGTCGGTATAAGTCGGTATCCCAATCAGCAGGAGTGAAAAGCCATATGCCTCGACTCTTCTGTTTCGCCAAACCGGTGGTGGAGGCAATTACTGGTTCTACGATCACGAGAGTGCAAGATCTTCACCACGGACAGAATAGAAACCGATTCCGTACCCTGTGTCTGCAGCCCCAAATAAACATGGGGAGCGATCCGAAAACGATGCCATGGAGGTGGATCCTATGATCAACCAGAAGGTCCTATGACTTATCGACAGCAGTTGGAGAACCCATGTCGCAGACCAGCAGACCAGGAGCAGATACGACACATAGATACGACACATCCAGACGCGGTC

Full Affymetrix probeset data:

Annotations for 1635396_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720