FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635397_at:

>probe:Drosophila_2:1635397_at:227:661; Interrogation_Position=1001; Antisense; TAACGCGATTGGCTGAGGATTCTCA
>probe:Drosophila_2:1635397_at:627:77; Interrogation_Position=1016; Antisense; AGGATTCTCACCTTTTGCTGGACAC
>probe:Drosophila_2:1635397_at:16:605; Interrogation_Position=1031; Antisense; TGCTGGACACTATAGTTCTGAACTT
>probe:Drosophila_2:1635397_at:261:189; Interrogation_Position=1056; Antisense; AACAGTCTACTTAAATGCCGCCTTT
>probe:Drosophila_2:1635397_at:636:625; Interrogation_Position=1071; Antisense; TGCCGCCTTTGGAATACTCATATTT
>probe:Drosophila_2:1635397_at:154:343; Interrogation_Position=1101; Antisense; GCTTATACTGAAGGGCAGCACATTT
>probe:Drosophila_2:1635397_at:615:587; Interrogation_Position=738; Antisense; TGAATGGTTGCCTTTGGTCGGTTAC
>probe:Drosophila_2:1635397_at:148:723; Interrogation_Position=764; Antisense; TTGGGTGCTCGGTTAAAGACTGGAA
>probe:Drosophila_2:1635397_at:582:405; Interrogation_Position=781; Antisense; GACTGGAATTCGTCTTCATGGTTCT
>probe:Drosophila_2:1635397_at:288:455; Interrogation_Position=846; Antisense; GATAATGTTCGTCCTAACAGCCATT
>probe:Drosophila_2:1635397_at:178:93; Interrogation_Position=940; Antisense; AGTTACATACAATTCGTGCGACTTT
>probe:Drosophila_2:1635397_at:7:297; Interrogation_Position=958; Antisense; CGACTTTTTCTAATTATGGGCGCAA
>probe:Drosophila_2:1635397_at:263:245; Interrogation_Position=969; Antisense; AATTATGGGCGCAAGTTGGCTACTT
>probe:Drosophila_2:1635397_at:21:571; Interrogation_Position=986; Antisense; GGCTACTTGACCAATTAACGCGATT

Paste this into a BLAST search page for me
TAACGCGATTGGCTGAGGATTCTCAAGGATTCTCACCTTTTGCTGGACACTGCTGGACACTATAGTTCTGAACTTAACAGTCTACTTAAATGCCGCCTTTTGCCGCCTTTGGAATACTCATATTTGCTTATACTGAAGGGCAGCACATTTTGAATGGTTGCCTTTGGTCGGTTACTTGGGTGCTCGGTTAAAGACTGGAAGACTGGAATTCGTCTTCATGGTTCTGATAATGTTCGTCCTAACAGCCATTAGTTACATACAATTCGTGCGACTTTCGACTTTTTCTAATTATGGGCGCAAAATTATGGGCGCAAGTTGGCTACTTGGCTACTTGACCAATTAACGCGATT

Full Affymetrix probeset data:

Annotations for 1635397_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720