FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635398_at:

>probe:Drosophila_2:1635398_at:368:671; Interrogation_Position=1008; Antisense; TACCAAGGCTTCGAGTAATGTGCAA
>probe:Drosophila_2:1635398_at:113:231; Interrogation_Position=1024; Antisense; AATGTGCAAGCTGTAGTATCTCTAC
>probe:Drosophila_2:1635398_at:117:509; Interrogation_Position=1069; Antisense; GTGTACCTTTACGAACTACGACTAT
>probe:Drosophila_2:1635398_at:493:707; Interrogation_Position=1112; Antisense; TTACGAGGTAGGATCTCCCACAGAT
>probe:Drosophila_2:1635398_at:62:449; Interrogation_Position=1134; Antisense; GATCCGTATCAATGTGGTGCGTAAA
>probe:Drosophila_2:1635398_at:579:681; Interrogation_Position=1185; Antisense; TATGTGTGTGTAGTCGTCGTTTATC
>probe:Drosophila_2:1635398_at:161:705; Interrogation_Position=1205; Antisense; TTATCGTCTCGCATCTATGGCGTAT
>probe:Drosophila_2:1635398_at:42:719; Interrogation_Position=705; Antisense; TTCGCCGCCGAGGATGTGAATGCGC
>probe:Drosophila_2:1635398_at:178:323; Interrogation_Position=726; Antisense; GCGCCTGGCAACTACATTTTTGGAA
>probe:Drosophila_2:1635398_at:231:213; Interrogation_Position=750; Antisense; AAGACCAGTTTCTAAGACCCAGCCA
>probe:Drosophila_2:1635398_at:473:385; Interrogation_Position=780; Antisense; GAACAGCTCCGATACTGGACATACT
>probe:Drosophila_2:1635398_at:588:447; Interrogation_Position=896; Antisense; GATCCGTCGTTGTTAGTTGAGTGTT
>probe:Drosophila_2:1635398_at:557:467; Interrogation_Position=911; Antisense; GTTGAGTGTTGTTTTCTCTCCAAGA
>probe:Drosophila_2:1635398_at:610:675; Interrogation_Position=972; Antisense; TAGCGTAATCTGTCTGCAAACTATT

Paste this into a BLAST search page for me
TACCAAGGCTTCGAGTAATGTGCAAAATGTGCAAGCTGTAGTATCTCTACGTGTACCTTTACGAACTACGACTATTTACGAGGTAGGATCTCCCACAGATGATCCGTATCAATGTGGTGCGTAAATATGTGTGTGTAGTCGTCGTTTATCTTATCGTCTCGCATCTATGGCGTATTTCGCCGCCGAGGATGTGAATGCGCGCGCCTGGCAACTACATTTTTGGAAAAGACCAGTTTCTAAGACCCAGCCAGAACAGCTCCGATACTGGACATACTGATCCGTCGTTGTTAGTTGAGTGTTGTTGAGTGTTGTTTTCTCTCCAAGATAGCGTAATCTGTCTGCAAACTATT

Full Affymetrix probeset data:

Annotations for 1635398_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720