FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635400_at:

>probe:Drosophila_2:1635400_at:182:13; Interrogation_Position=3839; Antisense; ATATACTGCCTACTAAAACCTCTAC
>probe:Drosophila_2:1635400_at:405:175; Interrogation_Position=3854; Antisense; AAACCTCTACTTCGGAGCTGTCTGA
>probe:Drosophila_2:1635400_at:601:417; Interrogation_Position=3868; Antisense; GAGCTGTCTGAAGGCGCTAAGGCCA
>probe:Drosophila_2:1635400_at:353:673; Interrogation_Position=3905; Antisense; TAGCGGAACGACTACACGAATTTCT
>probe:Drosophila_2:1635400_at:148:127; Interrogation_Position=3920; Antisense; ACGAATTTCTTGATCCGGAGACGAT
>probe:Drosophila_2:1635400_at:103:159; Interrogation_Position=4084; Antisense; ACACACACTTGCGATGGAAACTCAT
>probe:Drosophila_2:1635400_at:192:391; Interrogation_Position=4100; Antisense; GAAACTCATGTCCATCTAAGCTTGA
>probe:Drosophila_2:1635400_at:18:33; Interrogation_Position=4133; Antisense; ATCAATTCGCAAGCCTCAAAGGATT
>probe:Drosophila_2:1635400_at:101:91; Interrogation_Position=4198; Antisense; AGTAGTGTTATGAGCGCATCGCAAA
>probe:Drosophila_2:1635400_at:688:147; Interrogation_Position=4288; Antisense; ACTTCGTCAACGGATCTCATTAATT
>probe:Drosophila_2:1635400_at:203:249; Interrogation_Position=4344; Antisense; CAATCTTCAGATTTTGAGCGACGAA
>probe:Drosophila_2:1635400_at:199:467; Interrogation_Position=4375; Antisense; GTTGTGGTCGAAGAGCTCAGTGTCA
>probe:Drosophila_2:1635400_at:714:279; Interrogation_Position=4390; Antisense; CTCAGTGTCAATGCTCAGGTGTCGT
>probe:Drosophila_2:1635400_at:430:619; Interrogation_Position=4401; Antisense; TGCTCAGGTGTCGTCTTTTAAGTAA

Paste this into a BLAST search page for me
ATATACTGCCTACTAAAACCTCTACAAACCTCTACTTCGGAGCTGTCTGAGAGCTGTCTGAAGGCGCTAAGGCCATAGCGGAACGACTACACGAATTTCTACGAATTTCTTGATCCGGAGACGATACACACACTTGCGATGGAAACTCATGAAACTCATGTCCATCTAAGCTTGAATCAATTCGCAAGCCTCAAAGGATTAGTAGTGTTATGAGCGCATCGCAAAACTTCGTCAACGGATCTCATTAATTCAATCTTCAGATTTTGAGCGACGAAGTTGTGGTCGAAGAGCTCAGTGTCACTCAGTGTCAATGCTCAGGTGTCGTTGCTCAGGTGTCGTCTTTTAAGTAA

Full Affymetrix probeset data:

Annotations for 1635400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720