Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635403_at:

>probe:Drosophila_2:1635403_at:640:497; Interrogation_Position=1228; Antisense; GTCTCAATGGCGGTAACTGCACGGC
>probe:Drosophila_2:1635403_at:701:159; Interrogation_Position=1354; Antisense; ACAAGTGCCAGTGCTCCAAGGGTTA
>probe:Drosophila_2:1635403_at:300:473; Interrogation_Position=1375; Antisense; GTTACTACGGCCTGCGTTGCGAGTA
>probe:Drosophila_2:1635403_at:241:431; Interrogation_Position=1395; Antisense; GAGTACTCCAAGTGTGTGATCCCCT
>probe:Drosophila_2:1635403_at:481:517; Interrogation_Position=1406; Antisense; GTGTGTGATCCCCTGCAAGAACGAG
>probe:Drosophila_2:1635403_at:170:139; Interrogation_Position=1433; Antisense; ACGGTGCATCGGGAACAACCTGTGC
>probe:Drosophila_2:1635403_at:99:405; Interrogation_Position=1471; Antisense; GACTACGAGGCGATCACTGCGAGAT
>probe:Drosophila_2:1635403_at:456:123; Interrogation_Position=1507; Antisense; AGCGCTCCATCTGCAAGTGTCGCAA
>probe:Drosophila_2:1635403_at:106:145; Interrogation_Position=1555; Antisense; ACTGCAAGTGCCATCCGGGATTCTA
>probe:Drosophila_2:1635403_at:46:531; Interrogation_Position=1571; Antisense; GGGATTCTATGGACGCCACTGCAAC
>probe:Drosophila_2:1635403_at:245:61; Interrogation_Position=1612; Antisense; ATGTCCACCGAAACGATGACTCCAA
>probe:Drosophila_2:1635403_at:143:409; Interrogation_Position=1628; Antisense; TGACTCCAAGTTCTAGGGCTACCGG
>probe:Drosophila_2:1635403_at:218:673; Interrogation_Position=1647; Antisense; TACCGGCGCACACGATCCAAAATAT
>probe:Drosophila_2:1635403_at:589:255; Interrogation_Position=1685; Antisense; CACTTTTCTACTAAACCAGCACGAC

Paste this into a BLAST search page for me
GTCTCAATGGCGGTAACTGCACGGCACAAGTGCCAGTGCTCCAAGGGTTAGTTACTACGGCCTGCGTTGCGAGTAGAGTACTCCAAGTGTGTGATCCCCTGTGTGTGATCCCCTGCAAGAACGAGACGGTGCATCGGGAACAACCTGTGCGACTACGAGGCGATCACTGCGAGATAGCGCTCCATCTGCAAGTGTCGCAAACTGCAAGTGCCATCCGGGATTCTAGGGATTCTATGGACGCCACTGCAACATGTCCACCGAAACGATGACTCCAATGACTCCAAGTTCTAGGGCTACCGGTACCGGCGCACACGATCCAAAATATCACTTTTCTACTAAACCAGCACGAC

Full Affymetrix probeset data:

Annotations for 1635403_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime