FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635406_at:

>probe:Drosophila_2:1635406_at:597:417; Interrogation_Position=2005; Antisense; GAGCTCTAAGACGTGGACCTTCTGC
>probe:Drosophila_2:1635406_at:272:585; Interrogation_Position=2046; Antisense; TGGCACCCGAGATCATCCTGAACAA
>probe:Drosophila_2:1635406_at:324:223; Interrogation_Position=2069; Antisense; AAGGGTCACGATCGAGCCGTAGACT
>probe:Drosophila_2:1635406_at:576:301; Interrogation_Position=2085; Antisense; CCGTAGACTACTGGGCTTTGGGCAT
>probe:Drosophila_2:1635406_at:438:571; Interrogation_Position=2098; Antisense; GGCTTTGGGCATTCTCATTCATGAA
>probe:Drosophila_2:1635406_at:507:647; Interrogation_Position=2116; Antisense; TCATGAACTGCTCAACGGAACGCCA
>probe:Drosophila_2:1635406_at:454:629; Interrogation_Position=2152; Antisense; TCCAGATCCCATGCAGACGTACAAT
>probe:Drosophila_2:1635406_at:623:291; Interrogation_Position=2169; Antisense; CGTACAATCTCATCCTGAAGGGCAT
>probe:Drosophila_2:1635406_at:440:3; Interrogation_Position=2192; Antisense; ATTGACATGATAGCCTTTCCCAAGC
>probe:Drosophila_2:1635406_at:608:43; Interrogation_Position=2397; Antisense; ATCCGACGGATGTTCGCTACTTCGA
>probe:Drosophila_2:1635406_at:278:133; Interrogation_Position=2421; Antisense; ACCGCTTTCCGTGCGATTTGAACGA
>probe:Drosophila_2:1635406_at:469:17; Interrogation_Position=2436; Antisense; ATTTGAACGAGCCACCGGACGAGCT
>probe:Drosophila_2:1635406_at:302:529; Interrogation_Position=2469; Antisense; GGGATGCGGATTTCTAGGCCCATTC
>probe:Drosophila_2:1635406_at:677:501; Interrogation_Position=2495; Antisense; GTCGACCTCCTTGACTTAGTAATTG

Paste this into a BLAST search page for me
GAGCTCTAAGACGTGGACCTTCTGCTGGCACCCGAGATCATCCTGAACAAAAGGGTCACGATCGAGCCGTAGACTCCGTAGACTACTGGGCTTTGGGCATGGCTTTGGGCATTCTCATTCATGAATCATGAACTGCTCAACGGAACGCCATCCAGATCCCATGCAGACGTACAATCGTACAATCTCATCCTGAAGGGCATATTGACATGATAGCCTTTCCCAAGCATCCGACGGATGTTCGCTACTTCGAACCGCTTTCCGTGCGATTTGAACGAATTTGAACGAGCCACCGGACGAGCTGGGATGCGGATTTCTAGGCCCATTCGTCGACCTCCTTGACTTAGTAATTG

Full Affymetrix probeset data:

Annotations for 1635406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720