Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635407_at:

>probe:Drosophila_2:1635407_at:257:205; Interrogation_Position=1925; Antisense; AAGCGTTTTCGTCCTTGAATTCTGA
>probe:Drosophila_2:1635407_at:266:295; Interrogation_Position=1975; Antisense; CGAGTTCATCGATTAAAGCTAGCTT
>probe:Drosophila_2:1635407_at:656:205; Interrogation_Position=1990; Antisense; AAGCTAGCTTTTAGTTTTTCTGAGA
>probe:Drosophila_2:1635407_at:319:701; Interrogation_Position=2005; Antisense; TTTTCTGAGATGCACTTGTCCTACT
>probe:Drosophila_2:1635407_at:127:725; Interrogation_Position=2020; Antisense; TTGTCCTACTCTCGCATTGAGTTCA
>probe:Drosophila_2:1635407_at:270:473; Interrogation_Position=2040; Antisense; GTTCAGCATCAACTTTTTGGGTATC
>probe:Drosophila_2:1635407_at:571:529; Interrogation_Position=2058; Antisense; GGGTATCAGAATCCACTTAATTATC
>probe:Drosophila_2:1635407_at:576:611; Interrogation_Position=2084; Antisense; TGAAATCGGCGAGTGGACTTCCAAA
>probe:Drosophila_2:1635407_at:624:519; Interrogation_Position=2096; Antisense; GTGGACTTCCAAAACATCCCGAATT
>probe:Drosophila_2:1635407_at:88:289; Interrogation_Position=2130; Antisense; CGGCAAGCTGCTGGTTCAGTTTGGT
>probe:Drosophila_2:1635407_at:342:541; Interrogation_Position=2142; Antisense; GGTTCAGTTTGGTGTCTGTCTCCCA
>probe:Drosophila_2:1635407_at:527:599; Interrogation_Position=2158; Antisense; TGTCTCCCACTTCCTGTTTTGAATT
>probe:Drosophila_2:1635407_at:171:671; Interrogation_Position=2198; Antisense; TAGAGGAACCAAATGCCCCTGAATA
>probe:Drosophila_2:1635407_at:193:705; Interrogation_Position=2324; Antisense; TTATGCACATAACACCCACATCTAT

Paste this into a BLAST search page for me
AAGCGTTTTCGTCCTTGAATTCTGACGAGTTCATCGATTAAAGCTAGCTTAAGCTAGCTTTTAGTTTTTCTGAGATTTTCTGAGATGCACTTGTCCTACTTTGTCCTACTCTCGCATTGAGTTCAGTTCAGCATCAACTTTTTGGGTATCGGGTATCAGAATCCACTTAATTATCTGAAATCGGCGAGTGGACTTCCAAAGTGGACTTCCAAAACATCCCGAATTCGGCAAGCTGCTGGTTCAGTTTGGTGGTTCAGTTTGGTGTCTGTCTCCCATGTCTCCCACTTCCTGTTTTGAATTTAGAGGAACCAAATGCCCCTGAATATTATGCACATAACACCCACATCTAT

Full Affymetrix probeset data:

Annotations for 1635407_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime