Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635408_at:

>probe:Drosophila_2:1635408_at:405:531; Interrogation_Position=1264; Antisense; GGGTACGCGTTCAATGTTTGCCGGA
>probe:Drosophila_2:1635408_at:673:493; Interrogation_Position=1302; Antisense; GTCAAGGCATGCAACAGGCTTTCAG
>probe:Drosophila_2:1635408_at:711:697; Interrogation_Position=1321; Antisense; TTTCAGTTCTTCTTTCGGTGCTCAA
>probe:Drosophila_2:1635408_at:338:535; Interrogation_Position=1370; Antisense; GGTGCTCAACAAATCTTTTCCTCAT
>probe:Drosophila_2:1635408_at:597:703; Interrogation_Position=1440; Antisense; TTATGAGCGACTCTCTGCAGAACCA
>probe:Drosophila_2:1635408_at:265:109; Interrogation_Position=1458; Antisense; AGAACCACACAGTATACTCCTCAGA
>probe:Drosophila_2:1635408_at:37:663; Interrogation_Position=1484; Antisense; TACAAACCCTTTTCCAACGATGGCA
>probe:Drosophila_2:1635408_at:448:491; Interrogation_Position=1566; Antisense; GTAACATCTACGGTCCAGCTGGATC
>probe:Drosophila_2:1635408_at:619:357; Interrogation_Position=1611; Antisense; GCAACGGTGGTCAGGTCTATGGCAT
>probe:Drosophila_2:1635408_at:390:65; Interrogation_Position=1634; Antisense; ATGGGTGGTGCCTGCGACATGAATA
>probe:Drosophila_2:1635408_at:215:615; Interrogation_Position=1653; Antisense; TGAATATGAGCGCTTACCCTCTCAG
>probe:Drosophila_2:1635408_at:412:429; Interrogation_Position=1684; Antisense; GAGTTATTCAAGTCCCTATTCCTAC
>probe:Drosophila_2:1635408_at:262:691; Interrogation_Position=1700; Antisense; TATTCCTACGATATGCCTTGTTCCA
>probe:Drosophila_2:1635408_at:596:27; Interrogation_Position=1744; Antisense; ATCAGGTATTCCTATGGCTACTCCT

Paste this into a BLAST search page for me
GGGTACGCGTTCAATGTTTGCCGGAGTCAAGGCATGCAACAGGCTTTCAGTTTCAGTTCTTCTTTCGGTGCTCAAGGTGCTCAACAAATCTTTTCCTCATTTATGAGCGACTCTCTGCAGAACCAAGAACCACACAGTATACTCCTCAGATACAAACCCTTTTCCAACGATGGCAGTAACATCTACGGTCCAGCTGGATCGCAACGGTGGTCAGGTCTATGGCATATGGGTGGTGCCTGCGACATGAATATGAATATGAGCGCTTACCCTCTCAGGAGTTATTCAAGTCCCTATTCCTACTATTCCTACGATATGCCTTGTTCCAATCAGGTATTCCTATGGCTACTCCT

Full Affymetrix probeset data:

Annotations for 1635408_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime