FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635410_at:

>probe:Drosophila_2:1635410_at:698:383; Interrogation_Position=391; Antisense; GAACTGATTCCCAAAGATGCCAATG
>probe:Drosophila_2:1635410_at:484:483; Interrogation_Position=430; Antisense; GTAGACATTGATTACCTGGACACTT
>probe:Drosophila_2:1635410_at:486:109; Interrogation_Position=467; Antisense; AGAAGTTGGTTGACCTGGGCCTGAC
>probe:Drosophila_2:1635410_at:106:139; Interrogation_Position=518; Antisense; ACGAGGAGCAACTGACGCGCCTGTT
>probe:Drosophila_2:1635410_at:546:663; Interrogation_Position=584; Antisense; TACACCCCGCGTTGGATCAGAAGAA
>probe:Drosophila_2:1635410_at:382:105; Interrogation_Position=629; Antisense; AGAATGGAATCCTGGTGACCGCCTT
>probe:Drosophila_2:1635410_at:341:161; Interrogation_Position=671; Antisense; ACAATGCCGAGTTGAGGACGCCCAC
>probe:Drosophila_2:1635410_at:472:555; Interrogation_Position=686; Antisense; GGACGCCCACCTTTATGTACGATGG
>probe:Drosophila_2:1635410_at:498:645; Interrogation_Position=717; Antisense; TCAGGCCATCGCAGACAAGTACAAT
>probe:Drosophila_2:1635410_at:466:503; Interrogation_Position=744; Antisense; GTCCATTGCCCAAGTGGTGATCCGA
>probe:Drosophila_2:1635410_at:486:497; Interrogation_Position=841; Antisense; GTCTTCGATTTCAAGCTGGATGCTG
>probe:Drosophila_2:1635410_at:433:49; Interrogation_Position=872; Antisense; ATGCCATCTTGGACTCGTATCACAA
>probe:Drosophila_2:1635410_at:1:589; Interrogation_Position=897; Antisense; TGGAGAACGTGTTGCCCATGCCCGA
>probe:Drosophila_2:1635410_at:690:681; Interrogation_Position=943; Antisense; TATCCCTTCAACGTGTATAGTGCTT

Paste this into a BLAST search page for me
GAACTGATTCCCAAAGATGCCAATGGTAGACATTGATTACCTGGACACTTAGAAGTTGGTTGACCTGGGCCTGACACGAGGAGCAACTGACGCGCCTGTTTACACCCCGCGTTGGATCAGAAGAAAGAATGGAATCCTGGTGACCGCCTTACAATGCCGAGTTGAGGACGCCCACGGACGCCCACCTTTATGTACGATGGTCAGGCCATCGCAGACAAGTACAATGTCCATTGCCCAAGTGGTGATCCGAGTCTTCGATTTCAAGCTGGATGCTGATGCCATCTTGGACTCGTATCACAATGGAGAACGTGTTGCCCATGCCCGATATCCCTTCAACGTGTATAGTGCTT

Full Affymetrix probeset data:

Annotations for 1635410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720