FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635411_at:

>probe:Drosophila_2:1635411_at:478:471; Interrogation_Position=128; Antisense; GTTCAATTCGATGGTACCAGTCCCG
>probe:Drosophila_2:1635411_at:721:715; Interrogation_Position=14; Antisense; TTCCCATCCCATCCCAAATTATTTA
>probe:Drosophila_2:1635411_at:148:545; Interrogation_Position=178; Antisense; GGATACAAATGTTGCGCTTACAATC
>probe:Drosophila_2:1635411_at:172:55; Interrogation_Position=204; Antisense; ATGCAAGCCATAGAAGCCTACTCTT
>probe:Drosophila_2:1635411_at:204:205; Interrogation_Position=217; Antisense; AAGCCTACTCTTCATACACTATGTT
>probe:Drosophila_2:1635411_at:191:147; Interrogation_Position=283; Antisense; ACTACTAAAGATCGTTCCGCCTACA
>probe:Drosophila_2:1635411_at:664:697; Interrogation_Position=352; Antisense; TTTTCAATTCGATGGCACCGGTCCC
>probe:Drosophila_2:1635411_at:306:233; Interrogation_Position=428; Antisense; AATGCTAACATTTTGCTGCCTTTCC
>probe:Drosophila_2:1635411_at:2:27; Interrogation_Position=461; Antisense; ATACCTTACTGGATCGCATCGCCTG
>probe:Drosophila_2:1635411_at:143:45; Interrogation_Position=478; Antisense; ATCGCCTGCCTAGGATCAGTTGGAT
>probe:Drosophila_2:1635411_at:252:573; Interrogation_Position=504; Antisense; GGCTGAAATCGATCTTGTTTAACTG
>probe:Drosophila_2:1635411_at:162:239; Interrogation_Position=548; Antisense; AATAATCATACTGCACACTTCCGGT
>probe:Drosophila_2:1635411_at:522:287; Interrogation_Position=569; Antisense; CGGTCCCAAATGCTCAACATTCACA
>probe:Drosophila_2:1635411_at:407:147; Interrogation_Position=60; Antisense; ACTAATGATGATCGTTCCGCCTACA

Paste this into a BLAST search page for me
GTTCAATTCGATGGTACCAGTCCCGTTCCCATCCCATCCCAAATTATTTAGGATACAAATGTTGCGCTTACAATCATGCAAGCCATAGAAGCCTACTCTTAAGCCTACTCTTCATACACTATGTTACTACTAAAGATCGTTCCGCCTACATTTTCAATTCGATGGCACCGGTCCCAATGCTAACATTTTGCTGCCTTTCCATACCTTACTGGATCGCATCGCCTGATCGCCTGCCTAGGATCAGTTGGATGGCTGAAATCGATCTTGTTTAACTGAATAATCATACTGCACACTTCCGGTCGGTCCCAAATGCTCAACATTCACAACTAATGATGATCGTTCCGCCTACA

Full Affymetrix probeset data:

Annotations for 1635411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720