FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635412_at:

>probe:Drosophila_2:1635412_at:319:149; Interrogation_Position=109; Antisense; ACTTTTGTGGATGTGCAGTCGGTAA
>probe:Drosophila_2:1635412_at:28:319; Interrogation_Position=13; Antisense; GCCCCTGTGATTTTGACATTGCCGC
>probe:Drosophila_2:1635412_at:149:21; Interrogation_Position=147; Antisense; ATATATACTGACTGGCACGCCTTTG
>probe:Drosophila_2:1635412_at:91:573; Interrogation_Position=175; Antisense; GGCGGCAAAAGGGTACAGTTCAATA
>probe:Drosophila_2:1635412_at:57:237; Interrogation_Position=217; Antisense; AATCGAATCGGCATCACGGAAAATT
>probe:Drosophila_2:1635412_at:362:163; Interrogation_Position=237; Antisense; AAATTTGCCCACAGTTTTGATGCCC
>probe:Drosophila_2:1635412_at:614:257; Interrogation_Position=246; Antisense; CACAGTTTTGATGCCCGCCATTTGG
>probe:Drosophila_2:1635412_at:181:725; Interrogation_Position=25; Antisense; TTGACATTGCCGCACATGCTGGGCG
>probe:Drosophila_2:1635412_at:541:75; Interrogation_Position=275; Antisense; AGGAGGGCATTCAACTCAATGGTGA
>probe:Drosophila_2:1635412_at:148:279; Interrogation_Position=289; Antisense; CTCAATGGTGAAATGGTGGCCTTTT
>probe:Drosophila_2:1635412_at:363:725; Interrogation_Position=337; Antisense; TTGAAAACCCTCAACATCGTTCACT
>probe:Drosophila_2:1635412_at:380:189; Interrogation_Position=349; Antisense; AACATCGTTCACTGGGCGACCTTGT
>probe:Drosophila_2:1635412_at:222:331; Interrogation_Position=391; Antisense; GCGGTTGCGTGCCTGATATACTATA
>probe:Drosophila_2:1635412_at:91:595; Interrogation_Position=44; Antisense; TGGGCGCCTCGAATGAGTACCGCAA

Paste this into a BLAST search page for me
ACTTTTGTGGATGTGCAGTCGGTAAGCCCCTGTGATTTTGACATTGCCGCATATATACTGACTGGCACGCCTTTGGGCGGCAAAAGGGTACAGTTCAATAAATCGAATCGGCATCACGGAAAATTAAATTTGCCCACAGTTTTGATGCCCCACAGTTTTGATGCCCGCCATTTGGTTGACATTGCCGCACATGCTGGGCGAGGAGGGCATTCAACTCAATGGTGACTCAATGGTGAAATGGTGGCCTTTTTTGAAAACCCTCAACATCGTTCACTAACATCGTTCACTGGGCGACCTTGTGCGGTTGCGTGCCTGATATACTATATGGGCGCCTCGAATGAGTACCGCAA

Full Affymetrix probeset data:

Annotations for 1635412_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720