FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635413_at:

>probe:Drosophila_2:1635413_at:600:595; Interrogation_Position=101; Antisense; TGTGGCAAGCCGCAATTCCTGACCG
>probe:Drosophila_2:1635413_at:168:667; Interrogation_Position=128; Antisense; TACAGTGCGGCCTCGCCTGTGGTTG
>probe:Drosophila_2:1635413_at:58:711; Interrogation_Position=13; Antisense; TTCAATCAGCGGATATACCACCAAA
>probe:Drosophila_2:1635413_at:184:491; Interrogation_Position=196; Antisense; GTACAGTGCTGCCTACACCAGCGGC
>probe:Drosophila_2:1635413_at:87:633; Interrogation_Position=266; Antisense; TCGCTGTACCTGAGACGCTGAAGTT
>probe:Drosophila_2:1635413_at:486:613; Interrogation_Position=284; Antisense; TGAAGTTCCCACACCATCGAATGCA
>probe:Drosophila_2:1635413_at:375:369; Interrogation_Position=302; Antisense; GAATGCACACTGTACAACGATAATT
>probe:Drosophila_2:1635413_at:663:395; Interrogation_Position=320; Antisense; GATAATTCCCGATGACGTCGAACTA
>probe:Drosophila_2:1635413_at:696:463; Interrogation_Position=376; Antisense; GATTCGCATACCAAAGGCCAGCTAT
>probe:Drosophila_2:1635413_at:616:579; Interrogation_Position=391; Antisense; GGCCAGCTATTTGCTGTCATTTGCT
>probe:Drosophila_2:1635413_at:590:497; Interrogation_Position=406; Antisense; GTCATTTGCTTGGAGCAACTGCAGA
>probe:Drosophila_2:1635413_at:32:345; Interrogation_Position=457; Antisense; GCATTGGCTCTACACTCGCAGAAAA
>probe:Drosophila_2:1635413_at:99:603; Interrogation_Position=54; Antisense; TGTTCAAGTTTTTCGCTCTGTGCCT
>probe:Drosophila_2:1635413_at:558:305; Interrogation_Position=85; Antisense; CCTGTTGGCCGTTGCCTGTGGCAAG

Paste this into a BLAST search page for me
TGTGGCAAGCCGCAATTCCTGACCGTACAGTGCGGCCTCGCCTGTGGTTGTTCAATCAGCGGATATACCACCAAAGTACAGTGCTGCCTACACCAGCGGCTCGCTGTACCTGAGACGCTGAAGTTTGAAGTTCCCACACCATCGAATGCAGAATGCACACTGTACAACGATAATTGATAATTCCCGATGACGTCGAACTAGATTCGCATACCAAAGGCCAGCTATGGCCAGCTATTTGCTGTCATTTGCTGTCATTTGCTTGGAGCAACTGCAGAGCATTGGCTCTACACTCGCAGAAAATGTTCAAGTTTTTCGCTCTGTGCCTCCTGTTGGCCGTTGCCTGTGGCAAG

Full Affymetrix probeset data:

Annotations for 1635413_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720