Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635416_at:

>probe:Drosophila_2:1635416_at:483:479; Interrogation_Position=2015; Antisense; GTTTCCGGCGGAGATTCGTAATTCT
>probe:Drosophila_2:1635416_at:178:541; Interrogation_Position=2064; Antisense; GGTTATATATTTGGCTTCCTGGCAA
>probe:Drosophila_2:1635416_at:491:583; Interrogation_Position=2083; Antisense; TGGCAAACAAACTCTTCCTGCTGAT
>probe:Drosophila_2:1635416_at:244:639; Interrogation_Position=2123; Antisense; TCTGCCAGGAACTTTCGCTTTTTAT
>probe:Drosophila_2:1635416_at:724:263; Interrogation_Position=2150; Antisense; CAGTGTGGCATTCTTTGGAACCGTT
>probe:Drosophila_2:1635416_at:22:585; Interrogation_Position=2165; Antisense; TGGAACCGTTGTCCTGTACTTTACG
>probe:Drosophila_2:1635416_at:491:489; Interrogation_Position=2180; Antisense; GTACTTTACGCTTCCAGAGACAGAA
>probe:Drosophila_2:1635416_at:565:165; Interrogation_Position=2221; Antisense; AAATCGAAGCTCATTTCTCCAAGAA
>probe:Drosophila_2:1635416_at:324:235; Interrogation_Position=2245; Antisense; AATCCGATGTGAATCTGCTTCGCAA
>probe:Drosophila_2:1635416_at:590:547; Interrogation_Position=2297; Antisense; GGATGAGGCACAATTCCCCGGGAAT
>probe:Drosophila_2:1635416_at:142:359; Interrogation_Position=2333; Antisense; GCAAGGTAACTTCCAAGTGCCCATC
>probe:Drosophila_2:1635416_at:216:189; Interrogation_Position=2392; Antisense; AACAGAGCGATTTTACGCCGCGTTC
>probe:Drosophila_2:1635416_at:216:69; Interrogation_Position=2435; Antisense; AGGAGTTGGGTTGTCCAATCCTGCC
>probe:Drosophila_2:1635416_at:376:327; Interrogation_Position=2496; Antisense; GCGAGTGGACTGTGTCATCACCTAA

Paste this into a BLAST search page for me
GTTTCCGGCGGAGATTCGTAATTCTGGTTATATATTTGGCTTCCTGGCAATGGCAAACAAACTCTTCCTGCTGATTCTGCCAGGAACTTTCGCTTTTTATCAGTGTGGCATTCTTTGGAACCGTTTGGAACCGTTGTCCTGTACTTTACGGTACTTTACGCTTCCAGAGACAGAAAAATCGAAGCTCATTTCTCCAAGAAAATCCGATGTGAATCTGCTTCGCAAGGATGAGGCACAATTCCCCGGGAATGCAAGGTAACTTCCAAGTGCCCATCAACAGAGCGATTTTACGCCGCGTTCAGGAGTTGGGTTGTCCAATCCTGCCGCGAGTGGACTGTGTCATCACCTAA

Full Affymetrix probeset data:

Annotations for 1635416_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime