Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635417_a_at:

>probe:Drosophila_2:1635417_a_at:158:17; Interrogation_Position=116; Antisense; ATTTCCCGGCCAGAATGGACGTCGA
>probe:Drosophila_2:1635417_a_at:545:227; Interrogation_Position=129; Antisense; AATGGACGTCGATCCCGCAGAAGAG
>probe:Drosophila_2:1635417_a_at:603:137; Interrogation_Position=164; Antisense; ACGAGGCACATACGTCCATATACGA
>probe:Drosophila_2:1635417_a_at:569:301; Interrogation_Position=199; Antisense; CCCGATTTCGGCTACTTCAACATGG
>probe:Drosophila_2:1635417_a_at:589:651; Interrogation_Position=215; Antisense; TCAACATGGCCCACGGAATGCTGGT
>probe:Drosophila_2:1635417_a_at:619:37; Interrogation_Position=244; Antisense; ATCTCCGAGGAGATCCGGGCCAAGT
>probe:Drosophila_2:1635417_a_at:74:499; Interrogation_Position=284; Antisense; GTCTACGTTTCTCCCAGCTAAACAA
>probe:Drosophila_2:1635417_a_at:503:675; Interrogation_Position=317; Antisense; TAGCGGCCCGCAGTGGTCAGATGTT
>probe:Drosophila_2:1635417_a_at:669:495; Interrogation_Position=332; Antisense; GTCAGATGTTGAGCTTCGTCGAGAT
>probe:Drosophila_2:1635417_a_at:619:645; Interrogation_Position=356; Antisense; TCTTGAATTCGGTTAGCTGCAGGGC
>probe:Drosophila_2:1635417_a_at:220:535; Interrogation_Position=381; Antisense; GGTGCAGACCCACCTGGTGAATACA
>probe:Drosophila_2:1635417_a_at:729:83; Interrogation_Position=44; Antisense; AGTGGGCCTGTGTGGATTGCTTCCA
>probe:Drosophila_2:1635417_a_at:617:629; Interrogation_Position=65; Antisense; TCCATACCCATACCTGGTGATCAGT
>probe:Drosophila_2:1635417_a_at:133:605; Interrogation_Position=89; Antisense; TGATCACCGATCAGTGCAGCATCGT

Paste this into a BLAST search page for me
ATTTCCCGGCCAGAATGGACGTCGAAATGGACGTCGATCCCGCAGAAGAGACGAGGCACATACGTCCATATACGACCCGATTTCGGCTACTTCAACATGGTCAACATGGCCCACGGAATGCTGGTATCTCCGAGGAGATCCGGGCCAAGTGTCTACGTTTCTCCCAGCTAAACAATAGCGGCCCGCAGTGGTCAGATGTTGTCAGATGTTGAGCTTCGTCGAGATTCTTGAATTCGGTTAGCTGCAGGGCGGTGCAGACCCACCTGGTGAATACAAGTGGGCCTGTGTGGATTGCTTCCATCCATACCCATACCTGGTGATCAGTTGATCACCGATCAGTGCAGCATCGT

Full Affymetrix probeset data:

Annotations for 1635417_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime