Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635418_at:

>probe:Drosophila_2:1635418_at:92:49; Interrogation_Position=1018; Antisense; ATGCGCAAACTGCTGAAACCCTACT
>probe:Drosophila_2:1635418_at:400:111; Interrogation_Position=1048; Antisense; AGCAATCCGATTTACTTTGGCTCCC
>probe:Drosophila_2:1635418_at:397:207; Interrogation_Position=1078; Antisense; AAGCTGGGATCCACTCTCTACATGT
>probe:Drosophila_2:1635418_at:669:553; Interrogation_Position=1108; Antisense; GGAGCCGGCTATGTCCTGAGCAAAA
>probe:Drosophila_2:1635418_at:649:725; Interrogation_Position=1139; Antisense; TTGAGCTATTGAATCTTGGCGCCGC
>probe:Drosophila_2:1635418_at:183:321; Interrogation_Position=1159; Antisense; GCCGCCGAAAATTGCCAGCCAGGAG
>probe:Drosophila_2:1635418_at:567:49; Interrogation_Position=1215; Antisense; ATGCCTGAGCCTATTGCAAGTCCAA
>probe:Drosophila_2:1635418_at:529:551; Interrogation_Position=1243; Antisense; GGAGACTCCAGAGATCTGCTCGGAC
>probe:Drosophila_2:1635418_at:500:561; Interrogation_Position=1292; Antisense; TGGAACACTTTCTCATTCCGAATCG
>probe:Drosophila_2:1635418_at:648:287; Interrogation_Position=1332; Antisense; CTGGCTGCAGGAGTATCTCTACCAA
>probe:Drosophila_2:1635418_at:289:233; Interrogation_Position=1376; Antisense; AATGCTGTTCCACCTATTCAATTTC
>probe:Drosophila_2:1635418_at:449:197; Interrogation_Position=1408; Antisense; AACGTCTCTCCGTACGAAATGCATT
>probe:Drosophila_2:1635418_at:425:67; Interrogation_Position=1466; Antisense; ATGGACTTCTAGCTGGACATGCTCC
>probe:Drosophila_2:1635418_at:335:401; Interrogation_Position=1481; Antisense; GACATGCTCCTCCAAGAAGATTAAG

Paste this into a BLAST search page for me
ATGCGCAAACTGCTGAAACCCTACTAGCAATCCGATTTACTTTGGCTCCCAAGCTGGGATCCACTCTCTACATGTGGAGCCGGCTATGTCCTGAGCAAAATTGAGCTATTGAATCTTGGCGCCGCGCCGCCGAAAATTGCCAGCCAGGAGATGCCTGAGCCTATTGCAAGTCCAAGGAGACTCCAGAGATCTGCTCGGACTGGAACACTTTCTCATTCCGAATCGCTGGCTGCAGGAGTATCTCTACCAAAATGCTGTTCCACCTATTCAATTTCAACGTCTCTCCGTACGAAATGCATTATGGACTTCTAGCTGGACATGCTCCGACATGCTCCTCCAAGAAGATTAAG

Full Affymetrix probeset data:

Annotations for 1635418_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime