FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635419_at:

>probe:Drosophila_2:1635419_at:282:163; Interrogation_Position=2273; Antisense; AAATACTGTCAATCTCACCAGCCGG
>probe:Drosophila_2:1635419_at:150:377; Interrogation_Position=2337; Antisense; GAAGAAACCTATCGGCTCCTCTGTA
>probe:Drosophila_2:1635419_at:31:269; Interrogation_Position=2373; Antisense; CAGGATGATTCGTTCCACTTGGAGT
>probe:Drosophila_2:1635419_at:586:671; Interrogation_Position=2397; Antisense; TACCGCGGACCCGTTATCATGAAGG
>probe:Drosophila_2:1635419_at:52:175; Interrogation_Position=2424; Antisense; AAACCGACGCCCATGGACTGTTGGT
>probe:Drosophila_2:1635419_at:40:209; Interrogation_Position=2465; Antisense; AAGCAGCATTTTGGGAGGCACTTCC
>probe:Drosophila_2:1635419_at:347:389; Interrogation_Position=2515; Antisense; GAAACGGGAGCTTGGATTCGCCGCT
>probe:Drosophila_2:1635419_at:512:495; Interrogation_Position=2621; Antisense; GTCACGTACTTCGTCCGCAGGAGGA
>probe:Drosophila_2:1635419_at:112:563; Interrogation_Position=2675; Antisense; GGAACTGTGCAAGGACTCGTCCTGC
>probe:Drosophila_2:1635419_at:364:335; Interrogation_Position=2698; Antisense; GCTGCTGCTGAAACATCCTGTAAAG
>probe:Drosophila_2:1635419_at:69:663; Interrogation_Position=2718; Antisense; TAAAGTTGCCACTGCGTGCGTGACT
>probe:Drosophila_2:1635419_at:429:39; Interrogation_Position=2745; Antisense; ATCTGTCCGAATGTCTGCGGCCAAA
>probe:Drosophila_2:1635419_at:531:411; Interrogation_Position=2784; Antisense; GACCACTTAACCACTTCATTTCTAT
>probe:Drosophila_2:1635419_at:307:273; Interrogation_Position=2800; Antisense; CATTTCTATGCCTTTGTGTTTGTCA

Paste this into a BLAST search page for me
AAATACTGTCAATCTCACCAGCCGGGAAGAAACCTATCGGCTCCTCTGTACAGGATGATTCGTTCCACTTGGAGTTACCGCGGACCCGTTATCATGAAGGAAACCGACGCCCATGGACTGTTGGTAAGCAGCATTTTGGGAGGCACTTCCGAAACGGGAGCTTGGATTCGCCGCTGTCACGTACTTCGTCCGCAGGAGGAGGAACTGTGCAAGGACTCGTCCTGCGCTGCTGCTGAAACATCCTGTAAAGTAAAGTTGCCACTGCGTGCGTGACTATCTGTCCGAATGTCTGCGGCCAAAGACCACTTAACCACTTCATTTCTATCATTTCTATGCCTTTGTGTTTGTCA

Full Affymetrix probeset data:

Annotations for 1635419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720