Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635420_at:

>probe:Drosophila_2:1635420_at:278:55; Interrogation_Position=1028; Antisense; ATGACTTGGCCAGCTCCTTTGAGAC
>probe:Drosophila_2:1635420_at:532:121; Interrogation_Position=1064; Antisense; AGCGCTATGACCTTGACGCCCTGAT
>probe:Drosophila_2:1635420_at:182:449; Interrogation_Position=1086; Antisense; GATCCTGCACGAGGACTTTAGCCAA
>probe:Drosophila_2:1635420_at:71:383; Interrogation_Position=1128; Antisense; GAACGATATCGCCATGCTAAAGACG
>probe:Drosophila_2:1635420_at:705:227; Interrogation_Position=1155; Antisense; AATGGCGATCGTGTGGAGCCAGCAT
>probe:Drosophila_2:1635420_at:264:251; Interrogation_Position=1308; Antisense; CAAGGCCACGCTGGATGTTATCGAT
>probe:Drosophila_2:1635420_at:500:443; Interrogation_Position=1321; Antisense; GATGTTATCGATGGCCGCCGGTGCA
>probe:Drosophila_2:1635420_at:278:509; Interrogation_Position=1341; Antisense; GTGCAGGCAGGCTTTGAGCTCCGCC
>probe:Drosophila_2:1635420_at:26:559; Interrogation_Position=1410; Antisense; GGACACTTGCCAATATGACTCGGGA
>probe:Drosophila_2:1635420_at:388:437; Interrogation_Position=1433; Antisense; GAGGAGCACTTTACGAGCGGATCAA
>probe:Drosophila_2:1635420_at:322:121; Interrogation_Position=1448; Antisense; AGCGGATCAACGGACGCCTGATGGC
>probe:Drosophila_2:1635420_at:215:69; Interrogation_Position=1468; Antisense; ATGGCCGTGGGCATCGTCAGTTTTG
>probe:Drosophila_2:1635420_at:150:713; Interrogation_Position=1543; Antisense; TTCATCAAGTGGATCCGCACCAAGA
>probe:Drosophila_2:1635420_at:376:213; Interrogation_Position=1564; Antisense; AAGAGCCCCGAGGTGGCCTATTGTC

Paste this into a BLAST search page for me
ATGACTTGGCCAGCTCCTTTGAGACAGCGCTATGACCTTGACGCCCTGATGATCCTGCACGAGGACTTTAGCCAAGAACGATATCGCCATGCTAAAGACGAATGGCGATCGTGTGGAGCCAGCATCAAGGCCACGCTGGATGTTATCGATGATGTTATCGATGGCCGCCGGTGCAGTGCAGGCAGGCTTTGAGCTCCGCCGGACACTTGCCAATATGACTCGGGAGAGGAGCACTTTACGAGCGGATCAAAGCGGATCAACGGACGCCTGATGGCATGGCCGTGGGCATCGTCAGTTTTGTTCATCAAGTGGATCCGCACCAAGAAAGAGCCCCGAGGTGGCCTATTGTC

Full Affymetrix probeset data:

Annotations for 1635420_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime