FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635421_at:

>probe:Drosophila_2:1635421_at:337:153; Interrogation_Position=1010; Antisense; ACATGGTCCAGGAGCAGGGCACTGT
>probe:Drosophila_2:1635421_at:229:83; Interrogation_Position=1025; Antisense; AGGGCACTGTGCTCGACCGCATCGA
>probe:Drosophila_2:1635421_at:206:413; Interrogation_Position=1039; Antisense; GACCGCATCGACTACAACGTGGAGC
>probe:Drosophila_2:1635421_at:608:81; Interrogation_Position=1085; Antisense; AGGGATTGCGCCAGCTGCACAAGGC
>probe:Drosophila_2:1635421_at:323:215; Interrogation_Position=1135; Antisense; AAGATGTGCGTCATTCTCGTCCTGG
>probe:Drosophila_2:1635421_at:495:537; Interrogation_Position=1164; Antisense; GGTCACATTCTTCATGCTGCTGCTG
>probe:Drosophila_2:1635421_at:468:619; Interrogation_Position=1187; Antisense; TGCTCATCCTGACCAAGCTCTAGTT
>probe:Drosophila_2:1635421_at:185:647; Interrogation_Position=1238; Antisense; TCATTCCCGTCATTCGCTGTGTGTG
>probe:Drosophila_2:1635421_at:679:107; Interrogation_Position=755; Antisense; AGAACTTCGTCGACTCCTTCGACAA
>probe:Drosophila_2:1635421_at:730:287; Interrogation_Position=810; Antisense; CGGCAACGGCTATCTGTTCGAGGAC
>probe:Drosophila_2:1635421_at:288:603; Interrogation_Position=824; Antisense; TGTTCGAGGACGACGAGCAGGCCAT
>probe:Drosophila_2:1635421_at:671:575; Interrogation_Position=843; Antisense; GGCCATCGACGATCACTTCCAAAGG
>probe:Drosophila_2:1635421_at:280:219; Interrogation_Position=967; Antisense; AAGTCCATCTACGACCTGAACGACA
>probe:Drosophila_2:1635421_at:559:381; Interrogation_Position=984; Antisense; GAACGACATCTTCAAGGACCTGGGC

Paste this into a BLAST search page for me
ACATGGTCCAGGAGCAGGGCACTGTAGGGCACTGTGCTCGACCGCATCGAGACCGCATCGACTACAACGTGGAGCAGGGATTGCGCCAGCTGCACAAGGCAAGATGTGCGTCATTCTCGTCCTGGGGTCACATTCTTCATGCTGCTGCTGTGCTCATCCTGACCAAGCTCTAGTTTCATTCCCGTCATTCGCTGTGTGTGAGAACTTCGTCGACTCCTTCGACAACGGCAACGGCTATCTGTTCGAGGACTGTTCGAGGACGACGAGCAGGCCATGGCCATCGACGATCACTTCCAAAGGAAGTCCATCTACGACCTGAACGACAGAACGACATCTTCAAGGACCTGGGC

Full Affymetrix probeset data:

Annotations for 1635421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720