Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635422_s_at:

>probe:Drosophila_2:1635422_s_at:212:629; Interrogation_Position=1007; Antisense; TCCACTGTGCGACGACCTTGTAGAG
>probe:Drosophila_2:1635422_s_at:348:569; Interrogation_Position=1044; Antisense; GGCTTTGCAGGTCAATACCGTCTGG
>probe:Drosophila_2:1635422_s_at:432:135; Interrogation_Position=1123; Antisense; ACGACATTCCCGTTCTGTTCTTCAA
>probe:Drosophila_2:1635422_s_at:70:95; Interrogation_Position=1153; Antisense; AGTTCCTATGCATGCACCGGCTAAA
>probe:Drosophila_2:1635422_s_at:175:333; Interrogation_Position=1199; Antisense; GCTGGAGGCGCTAAACTAGTCCGAT
>probe:Drosophila_2:1635422_s_at:96:611; Interrogation_Position=712; Antisense; TGACGCCCAGTGATATCTACACCTG
>probe:Drosophila_2:1635422_s_at:663:585; Interrogation_Position=735; Antisense; TGGAACATGGTCACAGGCACACAAA
>probe:Drosophila_2:1635422_s_at:99:393; Interrogation_Position=771; Antisense; GAAAGCATACTTGGCGATCTACATG
>probe:Drosophila_2:1635422_s_at:20:307; Interrogation_Position=803; Antisense; CCTGTGCACGCATGACTTCAAACAA
>probe:Drosophila_2:1635422_s_at:207:591; Interrogation_Position=883; Antisense; TGGGTTGCGCTTTTATGGGCACGAC
>probe:Drosophila_2:1635422_s_at:82:309; Interrogation_Position=919; Antisense; CCATGGCCATGGTACTTGAGAAGCT
>probe:Drosophila_2:1635422_s_at:705:377; Interrogation_Position=938; Antisense; GAAGCTGGTGCCAAGCATTGATCAG
>probe:Drosophila_2:1635422_s_at:707:5; Interrogation_Position=954; Antisense; ATTGATCAGGTGGAGGGCCTTCCGT
>probe:Drosophila_2:1635422_s_at:311:293; Interrogation_Position=976; Antisense; CGTTGCTCACTTTGTATACCAGGGA

Paste this into a BLAST search page for me
TCCACTGTGCGACGACCTTGTAGAGGGCTTTGCAGGTCAATACCGTCTGGACGACATTCCCGTTCTGTTCTTCAAAGTTCCTATGCATGCACCGGCTAAAGCTGGAGGCGCTAAACTAGTCCGATTGACGCCCAGTGATATCTACACCTGTGGAACATGGTCACAGGCACACAAAGAAAGCATACTTGGCGATCTACATGCCTGTGCACGCATGACTTCAAACAATGGGTTGCGCTTTTATGGGCACGACCCATGGCCATGGTACTTGAGAAGCTGAAGCTGGTGCCAAGCATTGATCAGATTGATCAGGTGGAGGGCCTTCCGTCGTTGCTCACTTTGTATACCAGGGA

Full Affymetrix probeset data:

Annotations for 1635422_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime