FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635426_at:

>probe:Drosophila_2:1635426_at:664:659; Interrogation_Position=1029; Antisense; TAAGCCGCTCAAAAGCTGAACAGCT
>probe:Drosophila_2:1635426_at:180:121; Interrogation_Position=1050; Antisense; AGCTGTTTTGTTTCTGAGCACTCCT
>probe:Drosophila_2:1635426_at:168:259; Interrogation_Position=1068; Antisense; CACTCCTGTGTGCTAAATGATTTCG
>probe:Drosophila_2:1635426_at:277:603; Interrogation_Position=1085; Antisense; TGATTTCGGTATTTTGGCTTTTAGC
>probe:Drosophila_2:1635426_at:440:571; Interrogation_Position=1100; Antisense; GGCTTTTAGCACAAGTCGCGAGTCA
>probe:Drosophila_2:1635426_at:697:633; Interrogation_Position=1115; Antisense; TCGCGAGTCAGTGCTACCAGTATAT
>probe:Drosophila_2:1635426_at:244:581; Interrogation_Position=626; Antisense; TGGCCTCTGCCATCGAGATAATTGT
>probe:Drosophila_2:1635426_at:489:359; Interrogation_Position=656; Antisense; GCAAGCCTATCGTTTTGGGCAAACC
>probe:Drosophila_2:1635426_at:151:593; Interrogation_Position=671; Antisense; TGGGCAAACCGAATCAGCGGATTTT
>probe:Drosophila_2:1635426_at:43:411; Interrogation_Position=735; Antisense; GACGCTTGTCATTGGAAACTCGCTT
>probe:Drosophila_2:1635426_at:436:249; Interrogation_Position=796; Antisense; CAATCATTATTGGTGGGCTGCGATA
>probe:Drosophila_2:1635426_at:533:191; Interrogation_Position=878; Antisense; AACTTGTTCCAGATGCTTTTCTCTC
>probe:Drosophila_2:1635426_at:698:699; Interrogation_Position=894; Antisense; TTTTCTCTCCGGTCTTGCTTCTTTT
>probe:Drosophila_2:1635426_at:338:177; Interrogation_Position=977; Antisense; AAACATACCCAGCTGACCAAAAAGT

Paste this into a BLAST search page for me
TAAGCCGCTCAAAAGCTGAACAGCTAGCTGTTTTGTTTCTGAGCACTCCTCACTCCTGTGTGCTAAATGATTTCGTGATTTCGGTATTTTGGCTTTTAGCGGCTTTTAGCACAAGTCGCGAGTCATCGCGAGTCAGTGCTACCAGTATATTGGCCTCTGCCATCGAGATAATTGTGCAAGCCTATCGTTTTGGGCAAACCTGGGCAAACCGAATCAGCGGATTTTGACGCTTGTCATTGGAAACTCGCTTCAATCATTATTGGTGGGCTGCGATAAACTTGTTCCAGATGCTTTTCTCTCTTTTCTCTCCGGTCTTGCTTCTTTTAAACATACCCAGCTGACCAAAAAGT

Full Affymetrix probeset data:

Annotations for 1635426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720