FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635428_at:

>probe:Drosophila_2:1635428_at:638:233; Interrogation_Position=1001; Antisense; AATGCGATTGTTACACTGCCAAGGA
>probe:Drosophila_2:1635428_at:92:221; Interrogation_Position=1051; Antisense; AAGTGCCCCTCGGTGAATGGCCAAA
>probe:Drosophila_2:1635428_at:645:369; Interrogation_Position=1065; Antisense; GAATGGCCAAACGTACAAGCACTGC
>probe:Drosophila_2:1635428_at:47:433; Interrogation_Position=1090; Antisense; GAGTCCTGCGATGCCTGTGTGAAAC
>probe:Drosophila_2:1635428_at:162:597; Interrogation_Position=1105; Antisense; TGTGTGAAACCCAACTATGTGCATT
>probe:Drosophila_2:1635428_at:335:681; Interrogation_Position=1120; Antisense; TATGTGCATTGCTCCGACTGTAGAA
>probe:Drosophila_2:1635428_at:107:187; Interrogation_Position=1190; Antisense; AACAACACTGCTGGATGTGCGGCCA
>probe:Drosophila_2:1635428_at:227:315; Interrogation_Position=1220; Antisense; GCCATATCGAAACCAAGTGCCCAAA
>probe:Drosophila_2:1635428_at:639:219; Interrogation_Position=1234; Antisense; AAGTGCCCAAACTTCCGCAAGAGAA
>probe:Drosophila_2:1635428_at:517:133; Interrogation_Position=1261; Antisense; ACGAACTATACCAAAGGCTGCCTTT
>probe:Drosophila_2:1635428_at:55:561; Interrogation_Position=1308; Antisense; GGAAAAGCGATGCTCGTACCGCTCA
>probe:Drosophila_2:1635428_at:231:487; Interrogation_Position=1323; Antisense; GTACCGCTCAAAATACTTCAGGGAA
>probe:Drosophila_2:1635428_at:189:99; Interrogation_Position=905; Antisense; AGAGTCGGTTTTGTGGATCACCCGT
>probe:Drosophila_2:1635428_at:581:511; Interrogation_Position=928; Antisense; GTGAGGCTGTTCACCAACGTGCCAC

Paste this into a BLAST search page for me
AATGCGATTGTTACACTGCCAAGGAAAGTGCCCCTCGGTGAATGGCCAAAGAATGGCCAAACGTACAAGCACTGCGAGTCCTGCGATGCCTGTGTGAAACTGTGTGAAACCCAACTATGTGCATTTATGTGCATTGCTCCGACTGTAGAAAACAACACTGCTGGATGTGCGGCCAGCCATATCGAAACCAAGTGCCCAAAAAGTGCCCAAACTTCCGCAAGAGAAACGAACTATACCAAAGGCTGCCTTTGGAAAAGCGATGCTCGTACCGCTCAGTACCGCTCAAAATACTTCAGGGAAAGAGTCGGTTTTGTGGATCACCCGTGTGAGGCTGTTCACCAACGTGCCAC

Full Affymetrix probeset data:

Annotations for 1635428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720