Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635432_at:

>probe:Drosophila_2:1635432_at:282:143; Interrogation_Position=1021; Antisense; ACTGGAGCCAATCGATTACCGCCAT
>probe:Drosophila_2:1635432_at:135:553; Interrogation_Position=1081; Antisense; GGAGCTCTTCCCGAGAGTTCAGTGG
>probe:Drosophila_2:1635432_at:235:473; Interrogation_Position=1097; Antisense; GTTCAGTGGCTGGATTCGGGCAACA
>probe:Drosophila_2:1635432_at:553:365; Interrogation_Position=1134; Antisense; GAATAGAGAGTATCTGCCACCAGCT
>probe:Drosophila_2:1635432_at:726:69; Interrogation_Position=602; Antisense; AGGCCCAATGCCAGGTGTTCCATAT
>probe:Drosophila_2:1635432_at:390:81; Interrogation_Position=614; Antisense; AGGTGTTCCATATCTGTGCCCTCAA
>probe:Drosophila_2:1635432_at:86:567; Interrogation_Position=667; Antisense; GGCACAGTCTTCAGCCAGGAGACAT
>probe:Drosophila_2:1635432_at:187:273; Interrogation_Position=689; Antisense; CATTAGTCTGTGTGTGGTGGAACCA
>probe:Drosophila_2:1635432_at:693:377; Interrogation_Position=708; Antisense; GAACCAGTACGACTGCGTTTCGGCG
>probe:Drosophila_2:1635432_at:350:577; Interrogation_Position=729; Antisense; GGCGCCCAGCTTATATGCGAACAAT
>probe:Drosophila_2:1635432_at:265:13; Interrogation_Position=767; Antisense; ATTACTCCGAGAGAAGTGGCTCCAA
>probe:Drosophila_2:1635432_at:431:521; Interrogation_Position=782; Antisense; GTGGCTCCAATCTGAGAACATCGAA
>probe:Drosophila_2:1635432_at:580:413; Interrogation_Position=884; Antisense; GAGCCACCGGAGTGTCTCAGGTTGC
>probe:Drosophila_2:1635432_at:624:539; Interrogation_Position=903; Antisense; GGTTGCTGGATATAACTCCGGCCGG

Paste this into a BLAST search page for me
ACTGGAGCCAATCGATTACCGCCATGGAGCTCTTCCCGAGAGTTCAGTGGGTTCAGTGGCTGGATTCGGGCAACAGAATAGAGAGTATCTGCCACCAGCTAGGCCCAATGCCAGGTGTTCCATATAGGTGTTCCATATCTGTGCCCTCAAGGCACAGTCTTCAGCCAGGAGACATCATTAGTCTGTGTGTGGTGGAACCAGAACCAGTACGACTGCGTTTCGGCGGGCGCCCAGCTTATATGCGAACAATATTACTCCGAGAGAAGTGGCTCCAAGTGGCTCCAATCTGAGAACATCGAAGAGCCACCGGAGTGTCTCAGGTTGCGGTTGCTGGATATAACTCCGGCCGG

Full Affymetrix probeset data:

Annotations for 1635432_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime