FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635435_at:

>probe:Drosophila_2:1635435_at:62:75; Interrogation_Position=361; Antisense; AGGACAAGCTGCGATGCTGCACCAT
>probe:Drosophila_2:1635435_at:242:199; Interrogation_Position=433; Antisense; AATGCCGGCCACTCAAAACCTATTT
>probe:Drosophila_2:1635435_at:20:369; Interrogation_Position=464; Antisense; GAATGAGTGGACCAAGCGACCCCTT
>probe:Drosophila_2:1635435_at:438:89; Interrogation_Position=536; Antisense; AGTAGGTCGGTGCTTCCCGATGAAA
>probe:Drosophila_2:1635435_at:515:445; Interrogation_Position=554; Antisense; GATGAAATTCCAGCTGAGACGCACA
>probe:Drosophila_2:1635435_at:520:171; Interrogation_Position=581; Antisense; AAAGAATTGCCTGGACTGCGGAAAT
>probe:Drosophila_2:1635435_at:418:55; Interrogation_Position=604; Antisense; ATGAACTTTACTACCGGTATCCCAT
>probe:Drosophila_2:1635435_at:699:335; Interrogation_Position=647; Antisense; GCTGCTGATCAAGAACTGCTGCGAA
>probe:Drosophila_2:1635435_at:312:373; Interrogation_Position=669; Antisense; GAAGTGGAGGTCTATCCCGCCAAGA
>probe:Drosophila_2:1635435_at:509:109; Interrogation_Position=742; Antisense; AGAAGTTCGCCAACAGTCTGCTGAA
>probe:Drosophila_2:1635435_at:353:433; Interrogation_Position=777; Antisense; GAGTGCCGGTTGTTCACCTTAGCCA
>probe:Drosophila_2:1635435_at:115:707; Interrogation_Position=795; Antisense; TTAGCCAGCCAACTTGCGAAGCAGA
>probe:Drosophila_2:1635435_at:426:261; Interrogation_Position=823; Antisense; CACCTTTGGCGCCTGATGTTAGGAT
>probe:Drosophila_2:1635435_at:408:391; Interrogation_Position=901; Antisense; GAAAGAGTTCACTGTTCGGCAATAA

Paste this into a BLAST search page for me
AGGACAAGCTGCGATGCTGCACCATAATGCCGGCCACTCAAAACCTATTTGAATGAGTGGACCAAGCGACCCCTTAGTAGGTCGGTGCTTCCCGATGAAAGATGAAATTCCAGCTGAGACGCACAAAAGAATTGCCTGGACTGCGGAAATATGAACTTTACTACCGGTATCCCATGCTGCTGATCAAGAACTGCTGCGAAGAAGTGGAGGTCTATCCCGCCAAGAAGAAGTTCGCCAACAGTCTGCTGAAGAGTGCCGGTTGTTCACCTTAGCCATTAGCCAGCCAACTTGCGAAGCAGACACCTTTGGCGCCTGATGTTAGGATGAAAGAGTTCACTGTTCGGCAATAA

Full Affymetrix probeset data:

Annotations for 1635435_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720