FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635436_at:

>probe:Drosophila_2:1635436_at:434:69; Interrogation_Position=13; Antisense; ATGGCCACCTCGGAGCAGAGCAGGA
>probe:Drosophila_2:1635436_at:61:625; Interrogation_Position=131; Antisense; TGCCCACAATGTACCACTTCGATTT
>probe:Drosophila_2:1635436_at:562:485; Interrogation_Position=141; Antisense; GTACCACTTCGATTTTGGTAAGCCA
>probe:Drosophila_2:1635436_at:166:591; Interrogation_Position=156; Antisense; TGGTAAGCCATTCATAAGCACTTTG
>probe:Drosophila_2:1635436_at:226:209; Interrogation_Position=171; Antisense; AAGCACTTTGGCCAATTACAACTGT
>probe:Drosophila_2:1635436_at:669:11; Interrogation_Position=185; Antisense; ATTACAACTGTAAGCCCAGCGTAGG
>probe:Drosophila_2:1635436_at:484:129; Interrogation_Position=19; Antisense; ACCTCGGAGCAGAGCAGGAGGCCCC
>probe:Drosophila_2:1635436_at:609:139; Interrogation_Position=191; Antisense; ACTGTAAGCCCAGCGTAGGGAGCTT
>probe:Drosophila_2:1635436_at:454:321; Interrogation_Position=198; Antisense; GCCCAGCGTAGGGAGCTTGTCAATC
>probe:Drosophila_2:1635436_at:380:553; Interrogation_Position=209; Antisense; GGAGCTTGTCAATCGATTTCACACA
>probe:Drosophila_2:1635436_at:421:493; Interrogation_Position=216; Antisense; GTCAATCGATTTCACACACAAAAAA
>probe:Drosophila_2:1635436_at:379:77; Interrogation_Position=34; Antisense; AGGAGGCCCCTGGAGCCTATCTTTA
>probe:Drosophila_2:1635436_at:610:577; Interrogation_Position=38; Antisense; GGCCCCTGGAGCCTATCTTTATCGC
>probe:Drosophila_2:1635436_at:452:33; Interrogation_Position=89; Antisense; ATCACCATAGCTCCATAACGCGCAC

Paste this into a BLAST search page for me
ATGGCCACCTCGGAGCAGAGCAGGATGCCCACAATGTACCACTTCGATTTGTACCACTTCGATTTTGGTAAGCCATGGTAAGCCATTCATAAGCACTTTGAAGCACTTTGGCCAATTACAACTGTATTACAACTGTAAGCCCAGCGTAGGACCTCGGAGCAGAGCAGGAGGCCCCACTGTAAGCCCAGCGTAGGGAGCTTGCCCAGCGTAGGGAGCTTGTCAATCGGAGCTTGTCAATCGATTTCACACAGTCAATCGATTTCACACACAAAAAAAGGAGGCCCCTGGAGCCTATCTTTAGGCCCCTGGAGCCTATCTTTATCGCATCACCATAGCTCCATAACGCGCAC

Full Affymetrix probeset data:

Annotations for 1635436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720