FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635439_at:

>probe:Drosophila_2:1635439_at:316:109; Interrogation_Position=242; Antisense; AGAAGCCCAAGAACGTGCCGCCTGG
>probe:Drosophila_2:1635439_at:433:543; Interrogation_Position=265; Antisense; GGATTTGCGGCTCCAGGGTTTCCAT
>probe:Drosophila_2:1635439_at:372:539; Interrogation_Position=281; Antisense; GGTTTCCATCCACCTTGGGCAATAA
>probe:Drosophila_2:1635439_at:45:201; Interrogation_Position=301; Antisense; AATAACCCAGAGAACACCACGCGTA
>probe:Drosophila_2:1635439_at:44:127; Interrogation_Position=316; Antisense; ACCACGCGTAAGGATGTGCCCATTG
>probe:Drosophila_2:1635439_at:469:69; Interrogation_Position=350; Antisense; AGGCGCCAACTATTTCCGTAGTGAA
>probe:Drosophila_2:1635439_at:288:663; Interrogation_Position=384; Antisense; TAAACTGGGCAGAGCTGAGCCACTG
>probe:Drosophila_2:1635439_at:485:263; Interrogation_Position=429; Antisense; CAGCAAGGGCACTTCGAACGAGGAC
>probe:Drosophila_2:1635439_at:116:115; Interrogation_Position=506; Antisense; AGCAGTTGCAGGATGTCATGGCCAA
>probe:Drosophila_2:1635439_at:50:497; Interrogation_Position=520; Antisense; GTCATGGCCAACTTGCCTAGCAAGG
>probe:Drosophila_2:1635439_at:585:711; Interrogation_Position=580; Antisense; TTCTTCTATGACTTGACCTACCTAA
>probe:Drosophila_2:1635439_at:167:259; Interrogation_Position=609; Antisense; CACCTGGTTGCTCAACTTTGTCGAG
>probe:Drosophila_2:1635439_at:296:535; Interrogation_Position=657; Antisense; GGTGCAGCACTACTGGAAGCGATTC
>probe:Drosophila_2:1635439_at:610:541; Interrogation_Position=708; Antisense; GGATTAACTCCCAGCGGAGCCGAAA

Paste this into a BLAST search page for me
AGAAGCCCAAGAACGTGCCGCCTGGGGATTTGCGGCTCCAGGGTTTCCATGGTTTCCATCCACCTTGGGCAATAAAATAACCCAGAGAACACCACGCGTAACCACGCGTAAGGATGTGCCCATTGAGGCGCCAACTATTTCCGTAGTGAATAAACTGGGCAGAGCTGAGCCACTGCAGCAAGGGCACTTCGAACGAGGACAGCAGTTGCAGGATGTCATGGCCAAGTCATGGCCAACTTGCCTAGCAAGGTTCTTCTATGACTTGACCTACCTAACACCTGGTTGCTCAACTTTGTCGAGGGTGCAGCACTACTGGAAGCGATTCGGATTAACTCCCAGCGGAGCCGAAA

Full Affymetrix probeset data:

Annotations for 1635439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720