FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635443_at:

>probe:Drosophila_2:1635443_at:512:535; Interrogation_Position=116; Antisense; GGTCCATTCCTAAACAGCCATTTTT
>probe:Drosophila_2:1635443_at:264:55; Interrogation_Position=13; Antisense; ATGACACTGGACTGGAACTACGATG
>probe:Drosophila_2:1635443_at:26:313; Interrogation_Position=132; Antisense; GCCATTTTTCGAATATCTAAACGGT
>probe:Drosophila_2:1635443_at:378:539; Interrogation_Position=154; Antisense; GGTTTCTACAAGGACGCGTTCATCA
>probe:Drosophila_2:1635443_at:8:329; Interrogation_Position=169; Antisense; GCGTTCATCAAGAATGTGGGCCATT
>probe:Drosophila_2:1635443_at:290:517; Interrogation_Position=184; Antisense; GTGGGCCATTGCTCCAATATGGTGC
>probe:Drosophila_2:1635443_at:47:719; Interrogation_Position=211; Antisense; TTCGATGGCGATTTTGTGCCACCAT
>probe:Drosophila_2:1635443_at:6:629; Interrogation_Position=227; Antisense; TGCCACCATGGCCACGAAATGTTTA
>probe:Drosophila_2:1635443_at:717:433; Interrogation_Position=280; Antisense; GAGGGACTGCCAGATATTGCACCAG
>probe:Drosophila_2:1635443_at:656:615; Interrogation_Position=297; Antisense; TGCACCAGAGGGTTTCTACAAGCTA
>probe:Drosophila_2:1635443_at:309:133; Interrogation_Position=358; Antisense; ACCCTGATTGTTAAGGTCTCGCCAA
>probe:Drosophila_2:1635443_at:114:157; Interrogation_Position=47; Antisense; ACACTATGGTGGAGGCAGACGTTCA
>probe:Drosophila_2:1635443_at:50:105; Interrogation_Position=63; Antisense; AGACGTTCATCACTGCTCATCGGGT
>probe:Drosophila_2:1635443_at:384:457; Interrogation_Position=97; Antisense; GATTACAAAATGATGCCCTGGTCCA

Paste this into a BLAST search page for me
GGTCCATTCCTAAACAGCCATTTTTATGACACTGGACTGGAACTACGATGGCCATTTTTCGAATATCTAAACGGTGGTTTCTACAAGGACGCGTTCATCAGCGTTCATCAAGAATGTGGGCCATTGTGGGCCATTGCTCCAATATGGTGCTTCGATGGCGATTTTGTGCCACCATTGCCACCATGGCCACGAAATGTTTAGAGGGACTGCCAGATATTGCACCAGTGCACCAGAGGGTTTCTACAAGCTAACCCTGATTGTTAAGGTCTCGCCAAACACTATGGTGGAGGCAGACGTTCAAGACGTTCATCACTGCTCATCGGGTGATTACAAAATGATGCCCTGGTCCA

Full Affymetrix probeset data:

Annotations for 1635443_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720