Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635445_at:

>probe:Drosophila_2:1635445_at:367:427; Interrogation_Position=14845; Antisense; TAAGCGAACCGTGTTCAAACAAACA
>probe:Drosophila_2:1635445_at:517:175; Interrogation_Position=14887; Antisense; AAACCAACTCCAAAGAATGCTCAAA
>probe:Drosophila_2:1635445_at:514:179; Interrogation_Position=14965; Antisense; TATTAATCCCCGAGTTACTGACGTA
>probe:Drosophila_2:1635445_at:173:631; Interrogation_Position=14971; Antisense; TCCCCGAGTTACTGACGTATTACAT
>probe:Drosophila_2:1635445_at:406:707; Interrogation_Position=14990; Antisense; TTACATACAGTTACTACTACCCCTC
>probe:Drosophila_2:1635445_at:392:671; Interrogation_Position=15007; Antisense; TACCCCTCAACCTATCTATATATAC
>probe:Drosophila_2:1635445_at:348:151; Interrogation_Position=15030; Antisense; ACATATATGATCAACTACTAGTCGT
>probe:Drosophila_2:1635445_at:270:277; Interrogation_Position=15044; Antisense; CTACTAGTCGTAAAAGTTTGAGTGA
>probe:Drosophila_2:1635445_at:670:209; Interrogation_Position=15068; Antisense; AAGAATATTTTAGAGCGAGCCTGTC
>probe:Drosophila_2:1635445_at:700:101; Interrogation_Position=15079; Antisense; AGAGCGAGCCTGTCGAAACTTTCAA
>probe:Drosophila_2:1635445_at:579:415; Interrogation_Position=15084; Antisense; GAGCCTGTCGAAACTTTCAAGGATT
>probe:Drosophila_2:1635445_at:211:697; Interrogation_Position=15108; Antisense; TTTTCTAAACTATCAAACGAACGAG
>probe:Drosophila_2:1635445_at:484:429; Interrogation_Position=15130; Antisense; GAGTTATATTTACTAACCATTGCAA
>probe:Drosophila_2:1635445_at:507:457; Interrogation_Position=15210; Antisense; GATATCTAACACGAAAACGTAACCG

Paste this into a BLAST search page for me
TAAGCGAACCGTGTTCAAACAAACAAAACCAACTCCAAAGAATGCTCAAATATTAATCCCCGAGTTACTGACGTATCCCCGAGTTACTGACGTATTACATTTACATACAGTTACTACTACCCCTCTACCCCTCAACCTATCTATATATACACATATATGATCAACTACTAGTCGTCTACTAGTCGTAAAAGTTTGAGTGAAAGAATATTTTAGAGCGAGCCTGTCAGAGCGAGCCTGTCGAAACTTTCAAGAGCCTGTCGAAACTTTCAAGGATTTTTTCTAAACTATCAAACGAACGAGGAGTTATATTTACTAACCATTGCAAGATATCTAACACGAAAACGTAACCG

Full Affymetrix probeset data:

Annotations for 1635445_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime