FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635446_at:

>probe:Drosophila_2:1635446_at:689:241; Interrogation_Position=166; Antisense; AATACGTGTGGATACCACCGGCATC
>probe:Drosophila_2:1635446_at:265:545; Interrogation_Position=199; Antisense; GGATAATATCCATGTCTTTGCCGCC
>probe:Drosophila_2:1635446_at:546:177; Interrogation_Position=225; Antisense; AATACCCGGGTCTGCAGATCCAGCA
>probe:Drosophila_2:1635446_at:162:265; Interrogation_Position=293; Antisense; CAGACCGTGCGCTACAACATGGGAG
>probe:Drosophila_2:1635446_at:645:255; Interrogation_Position=347; Antisense; CAGACAGCCAACACTTACGAATTCC
>probe:Drosophila_2:1635446_at:525:705; Interrogation_Position=361; Antisense; TTACGAATTCCCACGGGCGCAAGAT
>probe:Drosophila_2:1635446_at:619:617; Interrogation_Position=393; Antisense; TGCAGCTTACCTATCCGGAGAACGG
>probe:Drosophila_2:1635446_at:601:563; Interrogation_Position=416; Antisense; GGCAAGGGTGCCACTGTATCCTACG
>probe:Drosophila_2:1635446_at:205:485; Interrogation_Position=431; Antisense; GTATCCTACGTGGAGCTGCTCTGCA
>probe:Drosophila_2:1635446_at:253:439; Interrogation_Position=495; Antisense; GAGGCATCGGCCAGAGCTTGATCTC
>probe:Drosophila_2:1635446_at:234:103; Interrogation_Position=507; Antisense; AGAGCTTGATCTCCATCGTGCTGGA
>probe:Drosophila_2:1635446_at:424:211; Interrogation_Position=545; Antisense; AAGAACTTCTCATACCAGGCTCTCT
>probe:Drosophila_2:1635446_at:599:571; Interrogation_Position=562; Antisense; GGCTCTCTACTACGGAGTCAACTAG
>probe:Drosophila_2:1635446_at:125:73; Interrogation_Position=588; Antisense; AGGCATTTGCATTAGTTCCTCGCTA

Paste this into a BLAST search page for me
AATACGTGTGGATACCACCGGCATCGGATAATATCCATGTCTTTGCCGCCAATACCCGGGTCTGCAGATCCAGCACAGACCGTGCGCTACAACATGGGAGCAGACAGCCAACACTTACGAATTCCTTACGAATTCCCACGGGCGCAAGATTGCAGCTTACCTATCCGGAGAACGGGGCAAGGGTGCCACTGTATCCTACGGTATCCTACGTGGAGCTGCTCTGCAGAGGCATCGGCCAGAGCTTGATCTCAGAGCTTGATCTCCATCGTGCTGGAAAGAACTTCTCATACCAGGCTCTCTGGCTCTCTACTACGGAGTCAACTAGAGGCATTTGCATTAGTTCCTCGCTA

Full Affymetrix probeset data:

Annotations for 1635446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720