FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635447_at:

>probe:Drosophila_2:1635447_at:480:519; Interrogation_Position=1478; Antisense; GTGGATTCCTGCAGATGTCCGGACT
>probe:Drosophila_2:1635447_at:92:503; Interrogation_Position=1494; Antisense; GTCCGGACTGCGTGTGGTGTACAAC
>probe:Drosophila_2:1635447_at:519:81; Interrogation_Position=1532; Antisense; AGGGCAAGCGAGTGGTTTCCGCACA
>probe:Drosophila_2:1635447_at:605:419; Interrogation_Position=1593; Antisense; GAGCATCAATGAGACGGCCCTGTAC
>probe:Drosophila_2:1635447_at:724:599; Interrogation_Position=1613; Antisense; TGTACCAAGTGATCGTGCCCCAGTT
>probe:Drosophila_2:1635447_at:457:371; Interrogation_Position=1645; Antisense; GAAGGCGGCGATGGCTACACTCTGA
>probe:Drosophila_2:1635447_at:424:605; Interrogation_Position=1667; Antisense; TGATCGAGGAGTCGGATCCCTTCAC
>probe:Drosophila_2:1635447_at:483:307; Interrogation_Position=1685; Antisense; CCTTCACCGAGAGCATGCAGCGAAA
>probe:Drosophila_2:1635447_at:194:589; Interrogation_Position=1727; Antisense; TGGAGTACCTGAAGCAGCGCCATTT
>probe:Drosophila_2:1635447_at:147:125; Interrogation_Position=1742; Antisense; AGCGCCATTTCGTGTATCCCGAGAT
>probe:Drosophila_2:1635447_at:721:709; Interrogation_Position=1784; Antisense; TTCACGAGAAGGCTGACACCGGATC
>probe:Drosophila_2:1635447_at:38:647; Interrogation_Position=1849; Antisense; TCTTCCCTGCTAACTAGATTCATCT
>probe:Drosophila_2:1635447_at:542:37; Interrogation_Position=1870; Antisense; ATCTAGTGGCACTTTCAGCTTCTCA
>probe:Drosophila_2:1635447_at:220:117; Interrogation_Position=1886; Antisense; AGCTTCTCATTTCAGAACCCCAATT

Paste this into a BLAST search page for me
GTGGATTCCTGCAGATGTCCGGACTGTCCGGACTGCGTGTGGTGTACAACAGGGCAAGCGAGTGGTTTCCGCACAGAGCATCAATGAGACGGCCCTGTACTGTACCAAGTGATCGTGCCCCAGTTGAAGGCGGCGATGGCTACACTCTGATGATCGAGGAGTCGGATCCCTTCACCCTTCACCGAGAGCATGCAGCGAAATGGAGTACCTGAAGCAGCGCCATTTAGCGCCATTTCGTGTATCCCGAGATTTCACGAGAAGGCTGACACCGGATCTCTTCCCTGCTAACTAGATTCATCTATCTAGTGGCACTTTCAGCTTCTCAAGCTTCTCATTTCAGAACCCCAATT

Full Affymetrix probeset data:

Annotations for 1635447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720